Transcript: Mouse XM_017312556.1

PREDICTED: Mus musculus casein kinase 2, alpha prime polypeptide (Csnk2a2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Csnk2a2 (13000)
Length:
2088
CDS:
623..1624

Additional Resources:

NCBI RefSeq record:
XM_017312556.1
NBCI Gene record:
Csnk2a2 (13000)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312556.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025664 GTGAAGTATTTGAGGCCATTA pLKO.1 777 CDS 100% 10.800 7.560 N Csnk2a2 n/a
2 TRCN0000321853 GTGAAGTATTTGAGGCCATTA pLKO_005 777 CDS 100% 10.800 7.560 N Csnk2a2 n/a
3 TRCN0000321793 TGATATCCTGGGACAACATTC pLKO_005 1384 CDS 100% 10.800 7.560 N Csnk2a2 n/a
4 TRCN0000194896 CCTCACAATGTCATGATAGAT pLKO.1 1049 CDS 100% 5.625 3.938 N CSNK2A2 n/a
5 TRCN0000318690 CCTCACAATGTCATGATAGAT pLKO_005 1049 CDS 100% 5.625 3.938 N CSNK2A2 n/a
6 TRCN0000000613 CGTGGTGGAACAAATATCATT pLKO.1 890 CDS 100% 5.625 3.938 N CSNK2A2 n/a
7 TRCN0000318689 CGTGGTGGAACAAATATCATT pLKO_005 890 CDS 100% 5.625 3.938 N CSNK2A2 n/a
8 TRCN0000000615 AGACCTAGATCCACACTTCAA pLKO.1 1363 CDS 100% 4.950 3.465 N CSNK2A2 n/a
9 TRCN0000025665 CAACAGAGATTGACCGCCAAA pLKO.1 1502 CDS 100% 4.050 2.835 N Csnk2a2 n/a
10 TRCN0000321855 CAACAGAGATTGACCGCCAAA pLKO_005 1502 CDS 100% 4.050 2.835 N Csnk2a2 n/a
11 TRCN0000025666 GTATGATTATAGCTTGGACAT pLKO.1 1198 CDS 100% 4.050 2.835 N Csnk2a2 n/a
12 TRCN0000025668 CAGGACAACTATGACCAGCTT pLKO.1 1280 CDS 100% 2.640 1.848 N Csnk2a2 n/a
13 TRCN0000321792 CAGGACAACTATGACCAGCTT pLKO_005 1280 CDS 100% 2.640 1.848 N Csnk2a2 n/a
14 TRCN0000000614 CTGGGACAACATTCACGGAAA pLKO.1 1391 CDS 100% 4.050 3.240 N CSNK2A2 n/a
15 TRCN0000318620 CTGGGACAACATTCACGGAAA pLKO_005 1391 CDS 100% 4.050 3.240 N CSNK2A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312556.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00382 pDONR223 100% 90% 94% None (many diffs) n/a
2 ccsbBroad304_00382 pLX_304 0% 90% 94% V5 (many diffs) n/a
3 TRCN0000481622 AGACTGACAGTCCTTCTTCCCCTG pLX_317 47.1% 90% 94% V5 (many diffs) n/a
4 TRCN0000489293 CACACGAACCTGTACAGAGAAATG pLX_317 35% 89.9% 93.7% V5 (many diffs) n/a
5 TRCN0000492298 ACCTTTATGCCGATCAATACAAAT pLX_317 41.1% 89.7% 93.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV