Transcript: Mouse XM_017315800.1

PREDICTED: Mus musculus adrenergic receptor, alpha 1a (Adra1a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Adra1a (11549)
Length:
14705
CDS:
1189..2589

Additional Resources:

NCBI RefSeq record:
XM_017315800.1
NBCI Gene record:
Adra1a (11549)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315800.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219382 ACGCTCCGTATCCACCGTAAA pLKO.1 1885 CDS 100% 10.800 15.120 N Adra1a n/a
2 TRCN0000026306 CCTTTCAGAATGTGCTGCGAA pLKO.1 2195 CDS 100% 2.640 3.696 N Adra1a n/a
3 TRCN0000219381 GCTAGGATTTCAGCATATAAT pLKO.1 6391 3UTR 100% 15.000 10.500 N Adra1a n/a
4 TRCN0000219385 AGTAAGCAGTGCCAAGAATAA pLKO.1 1929 CDS 100% 13.200 9.240 N Adra1a n/a
5 TRCN0000219384 CGCCAGCACAGGTGAACATTT pLKO.1 1238 CDS 100% 13.200 9.240 N Adra1a n/a
6 TRCN0000219389 CTCAGGAGAGACTTTCTATAA pLKO.1 2328 CDS 100% 13.200 9.240 N Adra1a n/a
7 TRCN0000026282 GCCCTGAAACTGGAGGTTTAT pLKO.1 6660 3UTR 100% 13.200 9.240 N Adra1a n/a
8 TRCN0000219380 GTTGCATCAACCCTATCATAT pLKO.1 2144 CDS 100% 13.200 9.240 N Adra1a n/a
9 TRCN0000219383 GACAGATGGAGTCCGTGAATG pLKO.1 2358 CDS 100% 10.800 7.560 N Adra1a n/a
10 TRCN0000219387 GGATGAGACCATCTGCCAAAT pLKO.1 1701 CDS 100% 10.800 7.560 N Adra1a n/a
11 TRCN0000219386 TGCCCTTCTCTGCCATCTTTG pLKO.1 1427 CDS 100% 10.800 7.560 N Adra1a n/a
12 TRCN0000026258 CCAAGTTCCAACCATTAAGAT pLKO.1 2529 CDS 100% 5.625 3.938 N Adra1a n/a
13 TRCN0000219388 TCGGTGACTCACTACTACATT pLKO.1 1363 CDS 100% 5.625 3.938 N Adra1a n/a
14 TRCN0000026238 CGAATTTCAAGCCACCGGAAA pLKO.1 2084 CDS 100% 4.050 2.835 N Adra1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315800.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488275 GGCTAGGCGGACTGTCGTCCAAGA pLX_317 18.2% 87.2% 92% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV