Transcript: Mouse XM_017316153.1

PREDICTED: Mus musculus polybromo 1 (Pbrm1), transcript variant X31, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pbrm1 (66923)
Length:
8121
CDS:
358..5430

Additional Resources:

NCBI RefSeq record:
XM_017316153.1
NBCI Gene record:
Pbrm1 (66923)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316153.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304682 ACCGGACAGATTCCGAAATAT pLKO_005 2924 CDS 100% 15.000 21.000 N Pbrm1 n/a
2 TRCN0000304681 GTGCAATATCCAGACTATTAT pLKO_005 1054 CDS 100% 15.000 21.000 N Pbrm1 n/a
3 TRCN0000081819 CCGCTATAATGAGAGTGACAA pLKO.1 4137 CDS 100% 4.950 6.930 N Pbrm1 n/a
4 TRCN0000081820 CGACAGGCATACAACCTAGAA pLKO.1 5401 CDS 100% 4.950 6.930 N Pbrm1 n/a
5 TRCN0000302290 CGACAGGCATACAACCTAGAA pLKO_005 5401 CDS 100% 4.950 6.930 N Pbrm1 n/a
6 TRCN0000081821 CGGGATGTCCATTTGTCCAAA pLKO.1 5266 CDS 100% 4.950 3.960 N Pbrm1 n/a
7 TRCN0000302345 CGGGATGTCCATTTGTCCAAA pLKO_005 5266 CDS 100% 4.950 3.960 N Pbrm1 n/a
8 TRCN0000081818 GCGGCATATTTGCTCTATTAA pLKO.1 5982 3UTR 100% 15.000 10.500 N Pbrm1 n/a
9 TRCN0000304680 TGTGAAGTTGGTCCTAGTTTA pLKO_005 5852 3UTR 100% 13.200 9.240 N Pbrm1 n/a
10 TRCN0000081822 TCTGCTAAAGTTGTAGATGAT pLKO.1 4198 CDS 100% 4.950 3.465 N Pbrm1 n/a
11 TRCN0000015996 CCAGACTATTATGAAGTGGTT pLKO.1 655 CDS 100% 2.640 1.848 N PBRM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316153.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000472158 TCATGCCGTGGGTCGGGTCGCGAC pLX_317 7.9% 87% 92.2% V5 (many diffs) n/a
2 ccsbBroadEn_15888 pDONR223 0% 16.8% 17.9% None (many diffs) n/a
3 ccsbBroad304_15888 pLX_304 0% 16.8% 17.9% V5 (many diffs) n/a
4 TRCN0000475263 TGTATTGCGATGGGCCACTCTCCT pLX_317 43.9% 16.8% 17.9% V5 (many diffs) n/a
Download CSV