Transcript: Mouse XM_017316773.1

PREDICTED: Mus musculus limb region 1 like (Lmbr1l), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lmbr1l (74775)
Length:
2750
CDS:
590..2224

Additional Resources:

NCBI RefSeq record:
XM_017316773.1
NBCI Gene record:
Lmbr1l (74775)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316773.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126111 GCATCCGCCATTGTAGACAAT pLKO.1 1100 CDS 100% 4.950 6.930 N Lmbr1l n/a
2 TRCN0000126113 CGCTTCAACTGGCTAGGCAAT pLKO.1 2030 CDS 100% 4.050 5.670 N Lmbr1l n/a
3 TRCN0000305557 CTCTACATCCTCTGCCATATC pLKO_005 683 CDS 100% 10.800 8.640 N Lmbr1l n/a
4 TRCN0000305607 ATCCAGGTTGTGCTGATATTT pLKO_005 1817 CDS 100% 15.000 10.500 N Lmbr1l n/a
5 TRCN0000305559 CATCGATGACACAGATCATTG pLKO_005 1914 CDS 100% 10.800 7.560 N Lmbr1l n/a
6 TRCN0000305605 GCAGCTCTGACTCGAAGAATC pLKO_005 1331 CDS 100% 10.800 7.560 N Lmbr1l n/a
7 TRCN0000126109 GCCATGTTTACATGATTTGAT pLKO.1 2519 3UTR 100% 5.625 3.938 N Lmbr1l n/a
8 TRCN0000353810 GCCATGTTTACATGATTTGAT pLKO_005 2519 3UTR 100% 5.625 3.938 N Lmbr1l n/a
9 TRCN0000126112 CTCGTCTTCCTTATGCCCTTT pLKO.1 956 CDS 100% 4.050 2.835 N Lmbr1l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316773.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08568 pDONR223 100% 77.5% 78.7% None (many diffs) n/a
2 ccsbBroad304_08568 pLX_304 0% 77.5% 78.7% V5 (many diffs) n/a
3 TRCN0000478741 TACAGCTGCTGTGGGTCAATCCGC pLX_317 18.4% 77.5% 78.7% V5 (many diffs) n/a
4 ccsbBroadEn_15910 pDONR223 0% 77.5% 78.7% None (many diffs) n/a
5 ccsbBroad304_15910 pLX_304 0% 77.5% 78.7% V5 (many diffs) n/a
6 TRCN0000469583 TTCAGCGCCCAATACCCGCTGGTA pLX_317 29.9% 77.5% 78.7% V5 (many diffs) n/a
7 ccsbBroadEn_12258 pDONR223 100% 74.5% 75.8% None (many diffs) n/a
8 ccsbBroad304_12258 pLX_304 0% 74.5% 75.8% V5 (many diffs) n/a
9 TRCN0000480182 TGTGATTCGCAGACCTGGGCTGCC pLX_317 23.8% 74.5% 75.8% V5 (many diffs) n/a
Download CSV