Transcript: Mouse XM_017316855.1

PREDICTED: Mus musculus B cell leukemia/lymphoma 6 (Bcl6), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Bcl6 (12053)
Length:
5155
CDS:
2078..4201

Additional Resources:

NCBI RefSeq record:
XM_017316855.1
NBCI Gene record:
Bcl6 (12053)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316855.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321439 GGCAAGTCCCTAATGAGTATA pLKO_005 2787 CDS 100% 13.200 18.480 N Bcl6 n/a
2 TRCN0000084654 CCGGCTCAATAATCTCGTGAA pLKO.1 3412 CDS 100% 4.050 5.670 N Bcl6 n/a
3 TRCN0000321438 CAAGCCAGCCGGCTCAATAAT pLKO_005 3404 CDS 100% 15.000 12.000 N Bcl6 n/a
4 TRCN0000084657 TGAGCAGTTTAGAGCCCATAA pLKO.1 2197 CDS 100% 10.800 8.640 N Bcl6 n/a
5 TRCN0000350566 CAACCTGAGGGAAGGCAATAT pLKO_005 2362 CDS 100% 13.200 9.240 N Bcl6 n/a
6 TRCN0000321365 GATGTTCTTCTCAACCTTAAT pLKO_005 2126 CDS 100% 13.200 9.240 N Bcl6 n/a
7 TRCN0000084653 GCTGTCAAAGAGAAGGCTTTA pLKO.1 4613 3UTR 100% 10.800 7.560 N Bcl6 n/a
8 TRCN0000084655 CGGCCTGTTCTACAGTATCTT pLKO.1 2239 CDS 100% 5.625 3.938 N Bcl6 n/a
9 TRCN0000084656 GAGAAGTGTAACCTGCACTTT pLKO.1 4061 CDS 100% 0.495 0.347 N Bcl6 n/a
10 TRCN0000321437 TGTCAAAGAGAAGGCTTTAAT pLKO_005 4615 3UTR 100% 15.000 9.000 N Bcl6 n/a
11 TRCN0000013603 CCCATGATGTAGTGCCTCTTT pLKO.1 4292 3UTR 100% 4.950 3.465 N BCL6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316855.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05882 pDONR223 100% 89% 94.4% None (many diffs) n/a
2 ccsbBroad304_05882 pLX_304 26.9% 89% 94.4% V5 (many diffs) n/a
3 TRCN0000476705 GTACTGAGTATCCACTCCTTGTCA pLX_317 13% 89% 94.4% V5 (many diffs) n/a
4 ccsbBroadEn_14547 pDONR223 52.8% 88.9% 94.2% None (many diffs) n/a
5 ccsbBroad304_14547 pLX_304 25.1% 88% 51.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV