Transcript: Mouse XM_017321400.1

PREDICTED: Mus musculus membrane associated guanylate kinase, WW and PDZ domain containing 1 (Magi1), transcript variant X22, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Magi1 (14924)
Length:
7733
CDS:
599..4240

Additional Resources:

NCBI RefSeq record:
XM_017321400.1
NBCI Gene record:
Magi1 (14924)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321400.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265724 AGCCGAGTAGATCCGAATATA pLKO_005 5763 3UTR 100% 15.000 21.000 N Magi1 n/a
2 TRCN0000079087 GCACAATCAAGTCGTGGATAT pLKO.1 2671 CDS 100% 10.800 15.120 N Magi1 n/a
3 TRCN0000079085 CGAGAATATAACATGGATCTT pLKO.1 3881 CDS 100% 4.950 6.930 N Magi1 n/a
4 TRCN0000361281 CGAAAGACTCCTGGATCAAAG pLKO_005 4671 3UTR 100% 10.800 8.640 N Magi1 n/a
5 TRCN0000265719 TTGGACAAAGAACCAATTATT pLKO_005 2303 CDS 100% 15.000 10.500 N Magi1 n/a
6 TRCN0000361230 CAACAAGGACCTACGACATTT pLKO_005 922 CDS 100% 13.200 9.240 N Magi1 n/a
7 TRCN0000265728 CACCCAGCCAGAGCTAATAAC pLKO_005 2485 CDS 100% 13.200 9.240 N Magi1 n/a
8 TRCN0000078699 GCACCTATGAAGGAAACTATT pLKO.1 1137 CDS 100% 13.200 9.240 N MAGI1 n/a
9 TRCN0000299723 GCACCTATGAAGGAAACTATT pLKO_005 1137 CDS 100% 13.200 9.240 N MAGI1 n/a
10 TRCN0000367970 GTGGATGGGACACCAGTAATT pLKO_005 3248 CDS 100% 13.200 9.240 N Magi1 n/a
11 TRCN0000265723 TTGACCCGGATGACCCTAATA pLKO_005 2256 CDS 100% 13.200 9.240 N Magi1 n/a
12 TRCN0000265725 AGCGAACAAAGTCCTACAATG pLKO_005 1257 CDS 100% 10.800 7.560 N Magi1 n/a
13 TRCN0000079086 CCTGAAATGAACAGTAGCTTT pLKO.1 1331 CDS 100% 4.950 3.465 N Magi1 n/a
14 TRCN0000079084 CGCACAATCAAGTCGTGGATA pLKO.1 2670 CDS 100% 4.950 3.465 N Magi1 n/a
15 TRCN0000079083 GCGCTGACAACACTTTGGAAA pLKO.1 4544 3UTR 100% 4.950 2.970 N Magi1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321400.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14933 pDONR223 34.2% 69.1% 18.1% None (many diffs) n/a
2 ccsbBroad304_14933 pLX_304 0% 69.1% 18.1% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000466717 CATAATCGCACCGCATGCTGTAGA pLX_317 5.7% 69.1% 18.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV