Transcript: Mouse XM_017321753.1

PREDICTED: Mus musculus sorting nexin 10 (Snx10), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Snx10 (71982)
Length:
2499
CDS:
294..899

Additional Resources:

NCBI RefSeq record:
XM_017321753.1
NBCI Gene record:
Snx10 (71982)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321753.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336508 CAACGCGTTGCTGGTACAATT pLKO_005 491 CDS 100% 13.200 18.480 N Snx10 n/a
2 TRCN0000336449 TTGGCGTATTAGTAGCATTTA pLKO_005 1215 3UTR 100% 13.200 18.480 N Snx10 n/a
3 TRCN0000336509 CGCCGACGTAGAGTATGATTC pLKO_005 791 CDS 100% 10.800 15.120 N Snx10 n/a
4 TRCN0000336507 GGCACTCTTATATCGACTATG pLKO_005 370 CDS 100% 10.800 15.120 N Snx10 n/a
5 TRCN0000105713 GCACTCTTATATCGACTATGA pLKO.1 371 CDS 100% 4.950 6.930 N Snx10 n/a
6 TRCN0000380876 TAGACGGTTTCCCGAAGAAGA pLKO_005 752 CDS 100% 4.950 6.930 N Snx10 n/a
7 TRCN0000105712 GCTTTAATGAATAGACGGTTT pLKO.1 741 CDS 100% 4.050 5.670 N Snx10 n/a
8 TRCN0000380830 ATCTGAACTCCGAGGACATTG pLKO_005 664 CDS 100% 10.800 8.640 N Snx10 n/a
9 TRCN0000105714 TGCTTTAATGAATAGACGGTT pLKO.1 740 CDS 100% 2.640 2.112 N Snx10 n/a
10 TRCN0000336510 AGCAGTTCTCATGGATGTAAA pLKO_005 852 CDS 100% 13.200 9.240 N Snx10 n/a
11 TRCN0000105710 GCCATTTACTTGGGTACTTAA pLKO.1 2150 3UTR 100% 13.200 9.240 N Snx10 n/a
12 TRCN0000105711 GCCATTCACAAGTTTGCTTTA pLKO.1 726 CDS 100% 10.800 7.560 N Snx10 n/a
13 TRCN0000379561 TGCACTCTTGCTTTCCGATAG pLKO_005 617 CDS 100% 6.000 4.200 N Snx10 n/a
14 TRCN0000137686 GCTTGGACACAGTAGTGATGA pLKO.1 830 CDS 100% 4.950 3.465 N SNX10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321753.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08131 pDONR223 100% 88.4% 95% None (many diffs) n/a
2 ccsbBroad304_08131 pLX_304 0% 88.4% 95% V5 (many diffs) n/a
3 TRCN0000471561 TATCCAGAATTGACTTTCCCCTGC pLX_317 75.9% 88.4% 95% V5 (many diffs) n/a
Download CSV