Transcript: Human XM_024446351.1

PREDICTED: Homo sapiens guanylate binding protein 1 (GBP1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GBP1 (2633)
Length:
2800
CDS:
388..1764

Additional Resources:

NCBI RefSeq record:
XM_024446351.1
NBCI Gene record:
GBP1 (2633)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446351.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116119 CGACGAAAGGCATGTACCATA pLKO.1 1738 CDS 100% 4.950 6.930 N GBP1 n/a
2 TRCN0000306990 CGACGAAAGGCATGTACCATA pLKO_005 1738 CDS 100% 4.950 6.930 N GBP1 n/a
3 TRCN0000116120 TGAGACGACGAAAGGCATGTA pLKO.1 1733 CDS 100% 4.950 6.930 N GBP1 n/a
4 TRCN0000308067 TACCACTCAGGAGAAGTTTAT pLKO_005 2002 3UTR 100% 0.000 0.000 N GBP1 n/a
5 TRCN0000296042 CCAGATGAGTACCTGACATAC pLKO_005 577 CDS 100% 10.800 7.560 N GBP1 n/a
6 TRCN0000308065 TCTATGACTGATGCAATTCTC pLKO_005 1393 CDS 100% 4.950 3.465 N GBP1 n/a
7 TRCN0000116117 CCTCTGTATCAACTCAGGAAA pLKO.1 1968 3UTR 100% 4.950 2.970 N GBP1 n/a
8 TRCN0000116118 CGGAAATTCTTCCCAAAGAAA pLKO.1 664 CDS 100% 0.563 0.338 N GBP1 n/a
9 TRCN0000288938 CGGAAATTCTTCCCAAAGAAA pLKO_005 664 CDS 100% 0.563 0.338 N GBP1 n/a
10 TRCN0000148170 GCAGACATACTTGAAATCCAA pLKO.1 1368 CDS 100% 3.000 1.500 Y GBP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446351.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06263 pDONR223 100% 76.7% 75.8% None (many diffs) n/a
2 ccsbBroad304_06263 pLX_304 0% 76.7% 75.8% V5 (many diffs) n/a
3 TRCN0000466638 CCGTTGTCGCAGGTAGGATGGTGT pLX_317 25.6% 76.7% 75.8% V5 (many diffs) n/a
4 ccsbBroadEn_10841 pDONR223 100% 24.4% 23.8% None (many diffs) n/a
5 ccsbBroad304_10841 pLX_304 0% 24.4% 23.8% V5 (many diffs) n/a
6 TRCN0000465445 GTGGGTAACAGGAGCAGAAACGGG pLX_317 24.2% 24.4% 23.8% V5 (many diffs) n/a
Download CSV