Transcript: Human XM_024447647.1

PREDICTED: Homo sapiens relaxin 2 (RLN2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RLN2 (6019)
Length:
1874
CDS:
1131..1640

Additional Resources:

NCBI RefSeq record:
XM_024447647.1
NBCI Gene record:
RLN2 (6019)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447647.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435586 ATTGTGCACATCTCGTATAAT pLKO_005 1651 3UTR 100% 15.000 7.500 Y RLN2 n/a
2 TRCN0000433333 TACAGTGCATTGGCTAATAAA pLKO_005 1572 CDS 100% 15.000 7.500 Y RLN2 n/a
3 TRCN0000148832 CTCATGGATGGAGGAAGTTAT pLKO.1 1157 CDS 100% 13.200 6.600 Y RLN2 n/a
4 TRCN0000120356 CCATCCTTCATCAACAAAGAT pLKO.1 1302 CDS 100% 5.625 2.813 Y Rln1 n/a
5 TRCN0000146706 CCATCCTTCATCAACAAAGAT pLKO.1 1302 CDS 100% 5.625 2.813 Y RLN2 n/a
6 TRCN0000150355 CCATCCTTCATCAACAAAGAT pLKO.1 1302 CDS 100% 5.625 2.813 Y RLN1 n/a
7 TRCN0000149368 GTGCCATCCTTCATCAACAAA pLKO.1 1299 CDS 100% 5.625 2.813 Y RLN2 n/a
8 TRCN0000148973 GCATTACCACAGCTACAACAA pLKO.1 1404 CDS 100% 4.950 2.475 Y RLN2 n/a
9 TRCN0000149932 GCCATCCTTCATCAACAAAGA pLKO.1 1301 CDS 100% 4.950 2.475 Y RLN2 n/a
10 TRCN0000151299 GATGAAGCTAATTGTGCACAT pLKO.1 1641 CDS 100% 4.050 2.025 Y RLN1 n/a
11 TRCN0000149344 GCTTGGATACTCATTCTCGAA pLKO.1 1537 CDS 100% 2.640 1.320 Y RLN2 n/a
12 TRCN0000152386 GAAGCTAATTGTGCACATCTT pLKO.1 1644 3UTR 100% 4.950 2.475 Y RLN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447647.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01403 pDONR223 100% 90.4% 89.7% None (many diffs) n/a
2 ccsbBroad304_01403 pLX_304 0% 90.4% 89.7% V5 (many diffs) n/a
3 TRCN0000471158 CCTACATTAGCGGATGTTGTTCTG pLX_317 84.2% 90.4% 89.7% V5 (many diffs) n/a
4 ccsbBroadEn_01399 pDONR223 100% 81.6% 73.5% None (many diffs) n/a
5 TRCN0000466101 TAATCCGTTCGAACCTTCCAGGAA pLX_317 59.8% 81.6% 73.5% V5 (many diffs) n/a
Download CSV