Transcript: Human XM_024447792.1

PREDICTED: Homo sapiens sideroflexin 2 (SFXN2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SFXN2 (118980)
Length:
2527
CDS:
79..1101

Additional Resources:

NCBI RefSeq record:
XM_024447792.1
NBCI Gene record:
SFXN2 (118980)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447792.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059484 GCATCACCCAAGTAGTTATTT pLKO.1 803 CDS 100% 15.000 21.000 N SFXN2 n/a
2 TRCN0000059486 TGCGGCTAACTGTGTCAATAT pLKO.1 687 CDS 100% 13.200 18.480 N SFXN2 n/a
3 TRCN0000436355 GAATTGCCAGTTTCCTATCTG pLKO_005 1003 CDS 100% 4.950 6.930 N SFXN2 n/a
4 TRCN0000425044 GCATGATCATCACGGGCTTCA pLKO_005 428 CDS 100% 4.050 3.240 N SFXN2 n/a
5 TRCN0000419351 GGACCAGTCTATTCCCATATT pLKO_005 1119 3UTR 100% 13.200 9.240 N SFXN2 n/a
6 TRCN0000432405 CAATGAATGCCTCATACTTAC pLKO_005 1230 3UTR 100% 10.800 7.560 N SFXN2 n/a
7 TRCN0000059487 GAGAGTGAAGCACTTCCTAAA pLKO.1 198 CDS 100% 10.800 7.560 N SFXN2 n/a
8 TRCN0000059485 CTACTTCAATAAGGGTCTCTA pLKO.1 1080 CDS 100% 4.950 3.465 N SFXN2 n/a
9 TRCN0000417056 GATGATCTTGCTGCCAGTCAT pLKO_005 849 CDS 100% 4.950 3.465 N SFXN2 n/a
10 TRCN0000059483 GCTTGAGAAATTGCACTTCAT pLKO.1 879 CDS 100% 4.950 3.465 N SFXN2 n/a
11 TRCN0000060503 CCTCTCAAGTAGCTGGGATTA pLKO.1 1755 3UTR 100% 10.800 5.400 Y NCCRP1 n/a
12 TRCN0000155576 CCTCTCAAGTAGCTGGGATTA pLKO.1 1755 3UTR 100% 10.800 5.400 Y KLHL30 n/a
13 TRCN0000165697 CCTCTCAAGTAGCTGGGATTA pLKO.1 1755 3UTR 100% 10.800 5.400 Y SLC48A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447792.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04734 pDONR223 100% 94.7% 94.7% None 1_54del n/a
2 ccsbBroad304_04734 pLX_304 0% 94.7% 94.7% V5 1_54del n/a
3 TRCN0000473648 CATCACTCCGAAACTTCTTTGTGG pLX_317 44.6% 94.7% 94.7% V5 1_54del n/a
Download CSV