Transcript: Human XM_024448685.1

PREDICTED: Homo sapiens RIC3 acetylcholine receptor chaperone (RIC3), transcript variant X21, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RIC3 (79608)
Length:
709
CDS:
33..587

Additional Resources:

NCBI RefSeq record:
XM_024448685.1
NBCI Gene record:
RIC3 (79608)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448685.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136657 GCTACATCAGCTCCGAGAAAT pLKO.1 663 3UTR 100% 13.200 9.240 N RIC3 n/a
2 TRCN0000136958 CCAAGAGAAACGGTTGCTACA pLKO.1 648 3UTR 100% 4.050 2.835 N RIC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448685.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489052 ACCCTCTTGCATGCCTGCACGGGG pLX_317 32.6% 48.6% 47.8% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488694 TTCTCCCTGACTACGATACCCGTC pLX_317 32.7% 48.3% 67.7% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_08936 pDONR223 100% 48.3% 47.2% None (many diffs) n/a
4 ccsbBroad304_08936 pLX_304 0% 48.3% 47.2% V5 (many diffs) n/a
5 TRCN0000469413 AAACCCGTTCCAAACCATGTGTCA pLX_317 39.7% 48.3% 47.2% V5 (many diffs) n/a
Download CSV