Transcript: Human XM_024448957.1

PREDICTED: Homo sapiens dpy-19 like 2 (DPY19L2), transcript variant X29, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DPY19L2 (283417)
Length:
1394
CDS:
153..1379

Additional Resources:

NCBI RefSeq record:
XM_024448957.1
NBCI Gene record:
DPY19L2 (283417)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448957.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448957.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13716 pDONR223 100% 55.8% 47.5% None (many diffs) n/a
2 ccsbBroad304_13716 pLX_304 0% 55.8% 47.5% V5 (many diffs) n/a
3 TRCN0000470811 CCTGGTTGCCCCTCTAGGGCTTGA pLX_317 68.2% 55.8% 47.5% V5 (many diffs) n/a
4 ccsbBroadEn_09943 pDONR223 100% 53.4% 52.9% None (many diffs) n/a
5 ccsbBroadEn_13703 pDONR223 100% 32% 25.1% None (many diffs) n/a
6 ccsbBroad304_13703 pLX_304 0% 32% 25.1% V5 (many diffs) n/a
7 TRCN0000477859 TCGCCTAGCCGTATGAGCCGAAAT pLX_317 70.2% 32% 25.1% V5 (many diffs) n/a
8 ccsbBroadEn_10360 pDONR223 100% 27.5% 20% None (many diffs) n/a
9 ccsbBroad304_10360 pLX_304 0% 27.5% 20% V5 (many diffs) n/a
10 TRCN0000474402 ATCCGACGCAGTTTGAGACACATC pLX_317 100% 27.5% 20% V5 (many diffs) n/a
Download CSV