Transcript: Human XM_024449045.1

PREDICTED: Homo sapiens solute carrier family 48 member 1 (SLC48A1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC48A1 (55652)
Length:
3581
CDS:
557..1111

Additional Resources:

NCBI RefSeq record:
XM_024449045.1
NBCI Gene record:
SLC48A1 (55652)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449045.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163781 GCAACAAAGTCAAGAGGTCAA pLKO.1 1748 3UTR 100% 4.050 5.670 N SLC48A1 n/a
2 TRCN0000165394 CTTTCGAGGAAACCTGAGTGT pLKO.1 1275 3UTR 100% 2.640 3.696 N SLC48A1 n/a
3 TRCN0000415778 AGAGGGCAGCTTTAGACCTTT pLKO_005 1340 3UTR 100% 4.950 3.465 N SLC48A1 n/a
4 TRCN0000162221 CAGTGAGGAATCTTTGTACTT pLKO.1 1718 3UTR 100% 4.950 3.465 N SLC48A1 n/a
5 TRCN0000163733 GCAGTGAGGAATCTTTGTACT pLKO.1 1717 3UTR 100% 4.950 3.465 N SLC48A1 n/a
6 TRCN0000161395 GAATCTTTGTACTTAAGGCCA pLKO.1 1725 3UTR 100% 0.660 0.462 N SLC48A1 n/a
7 TRCN0000414549 ATCAGCATCCTCAGCGATTTC pLKO_005 1088 CDS 100% 10.800 6.480 N SLC48A1 n/a
8 TRCN0000190335 CTGGAGCTTCATTTCCTTCAA pLKO.1 1012 CDS 100% 4.950 2.970 N Slc48a1 n/a
9 TRCN0000162795 CTTCCAAAGTGCTGGGATTAT pLKO.1 1652 3UTR 100% 13.200 6.600 Y SLC48A1 n/a
10 TRCN0000060503 CCTCTCAAGTAGCTGGGATTA pLKO.1 1516 3UTR 100% 10.800 5.400 Y NCCRP1 n/a
11 TRCN0000155576 CCTCTCAAGTAGCTGGGATTA pLKO.1 1516 3UTR 100% 10.800 5.400 Y KLHL30 n/a
12 TRCN0000165697 CCTCTCAAGTAGCTGGGATTA pLKO.1 1516 3UTR 100% 10.800 5.400 Y SLC48A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449045.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03622 pDONR223 100% 67.9% 54.3% None (many diffs) n/a
2 ccsbBroad304_03622 pLX_304 0% 67.9% 54.3% V5 (many diffs) n/a
3 ccsbBroadEn_12240 pDONR223 100% 48.3% 48.3% None 1_285del n/a
4 ccsbBroad304_12240 pLX_304 0% 48.3% 48.3% V5 1_285del n/a
5 TRCN0000465396 ATGTGTGAGAATGTTATACCAGTC pLX_317 100% 48.3% 48.3% V5 1_285del n/a
Download CSV