Transcript: Human XM_024451693.1

PREDICTED: Homo sapiens zinc finger protein 91 (ZNF91), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF91 (7644)
Length:
1570
CDS:
114..470

Additional Resources:

NCBI RefSeq record:
XM_024451693.1
NBCI Gene record:
ZNF91 (7644)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451693.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420667 GCCAGACCTGATTACTTATCT pLKO_005 287 CDS 100% 5.625 3.938 N ZNF91 n/a
2 TRCN0000074123 CGCCTGTAATCCCAACACTTT pLKO.1 1303 3UTR 100% 4.950 2.475 Y GJD4 n/a
3 TRCN0000166650 CGCCTGTAATCCCAACACTTT pLKO.1 1303 3UTR 100% 4.950 2.475 Y C9orf85 n/a
4 TRCN0000018502 GATGTTAGAGAACTACAGAAA pLKO.1 236 CDS 100% 4.950 2.475 Y ZNF493 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451693.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11384 pDONR223 100% 69.9% 66.1% None (many diffs) n/a
2 ccsbBroad304_11384 pLX_304 0% 69.9% 66.1% V5 (many diffs) n/a
3 TRCN0000470576 TACATACAGACCTACACGTAGACC pLX_317 100% 69.9% 66.1% V5 (many diffs) n/a
4 ccsbBroadEn_13746 pDONR223 100% 60.1% 55.9% None (many diffs) n/a
5 ccsbBroad304_13746 pLX_304 0% 60.1% 55.9% V5 (many diffs) n/a
6 TRCN0000475669 ATTCGCAGCGAGTTTGTCCGCCGC pLX_317 100% 60.1% 55.9% V5 (many diffs) n/a
7 ccsbBroadEn_15729 pDONR223 0% 59% 53.7% None (many diffs) n/a
8 ccsbBroad304_15729 pLX_304 0% 59% 53.7% V5 (many diffs) n/a
9 TRCN0000470492 GCCGACTTGCTCCATGATGCAGCT pLX_317 100% 59% 53.7% V5 (many diffs) n/a
10 ccsbBroadEn_02188 pDONR223 100% 15.5% 12% None (many diffs) n/a
11 ccsbBroad304_02188 pLX_304 0% 15.5% 12% V5 (many diffs) n/a
12 TRCN0000476436 TCCGTGTTGGTCAAGCGACGCGCC pLX_317 12.5% 15.5% 12% V5 (many diffs) n/a
Download CSV