Transcript: Human XM_024453709.1

PREDICTED: Homo sapiens myotubularin related protein 14 (MTMR14), transcript variant X16, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MTMR14 (64419)
Length:
2093
CDS:
240..1673

Additional Resources:

NCBI RefSeq record:
XM_024453709.1
NBCI Gene record:
MTMR14 (64419)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453709.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000284873 TTCGATACCTGTCAGTCAAAT pLKO_005 484 CDS 100% 13.200 18.480 N MTMR14 n/a
2 TRCN0000002624 CAAGGAATATAAAGATCGGGA pLKO.1 641 CDS 100% 0.660 0.924 N MTMR14 n/a
3 TRCN0000284885 AGAAGCCAGCCCATGACATTT pLKO_005 1674 CDS 100% 13.200 9.240 N MTMR14 n/a
4 TRCN0000284883 CGGTTTGTCTGCCCAGTAATC pLKO_005 258 CDS 100% 10.800 7.560 N MTMR14 n/a
5 TRCN0000381217 GCCCTTAGCAGAGAATCAAAG pLKO_005 1716 3UTR 100% 10.800 7.560 N MTMR14 n/a
6 TRCN0000381664 TTGGGATCTGGTGCAACAAAC pLKO_005 776 CDS 100% 10.800 7.560 N MTMR14 n/a
7 TRCN0000002626 TGGAAGCAGGACTACGTTGAT pLKO.1 690 CDS 100% 4.950 3.465 N MTMR14 n/a
8 TRCN0000272927 TGGAAGCAGGACTACGTTGAT pLKO_005 690 CDS 100% 4.950 3.465 N MTMR14 n/a
9 TRCN0000002623 CGACTTCACTCTCCTCTCCAT pLKO.1 596 CDS 100% 2.640 1.848 N MTMR14 n/a
10 TRCN0000002625 GAAGCATATTACCTCCGAGGA pLKO.1 1067 CDS 100% 2.160 1.512 N MTMR14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453709.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15966 pDONR223 0% 87.4% 87.4% None 1070_1249del n/a
2 ccsbBroad304_15966 pLX_304 0% 87.4% 87.4% V5 1070_1249del n/a
3 TRCN0000467037 CCCGTTGAGCGTCTTGCGCTGGGC pLX_317 23.5% 87.4% 87.4% V5 1070_1249del n/a
4 ccsbBroadEn_03948 pDONR223 99.5% 79.7% 79.7% None 0_1ins363 n/a
5 ccsbBroad304_03948 pLX_304 0% 79.7% 79.7% V5 0_1ins363 n/a
6 TRCN0000472308 TTCGGCTATACTGTCGTCTGCGCA pLX_317 28.3% 79.7% 79.7% V5 0_1ins363 n/a
7 ccsbBroadEn_03947 pDONR223 100% 73.3% 73.3% None 0_1ins363;1250_1251ins156 n/a
8 ccsbBroad304_03947 pLX_304 0% 73.3% 73.3% V5 0_1ins363;1250_1251ins156 n/a
9 TRCN0000470894 AGCTTAAAGGCTTCACAACATCTT pLX_317 18.5% 73.3% 73.3% V5 0_1ins363;1250_1251ins156 n/a
Download CSV