Transcript: Human XM_024454123.1

PREDICTED: Homo sapiens F-box and WD repeat domain containing 7 (FBXW7), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FBXW7 (55294)
Length:
5754
CDS:
2008..4131

Additional Resources:

NCBI RefSeq record:
XM_024454123.1
NBCI Gene record:
FBXW7 (55294)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024454123.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235424 GGCAACAACGACGCCGAATTA pLKO_005 2663 CDS 100% 13.200 18.480 N FBXW7 n/a
2 TRCN0000235420 GGCATACTAATAGAGTCTATT pLKO_005 3623 CDS 100% 13.200 18.480 N FBXW7 n/a
3 TRCN0000006557 CCAGTCGTTAACAAGTGGAAT pLKO.1 3747 CDS 100% 4.950 6.930 N FBXW7 n/a
4 TRCN0000006555 CCTAAAGAGTTGGCACTCTAT pLKO.1 2860 CDS 100% 0.495 0.693 N FBXW7 n/a
5 TRCN0000368359 TCAAACCAGGTGCAATTATTT pLKO_005 4408 3UTR 100% 15.000 12.000 N FBXW7 n/a
6 TRCN0000355643 AGTTTCAACGAGACTTCATTT pLKO_005 2831 CDS 100% 13.200 9.240 N FBXW7 n/a
7 TRCN0000235421 CCAATTGTGTAGACGATATAC pLKO_005 4154 3UTR 100% 13.200 9.240 N FBXW7 n/a
8 TRCN0000355641 CTCTTAGGGTTTGGGATATTG pLKO_005 3452 CDS 100% 13.200 9.240 N FBXW7 n/a
9 TRCN0000355642 ACTTCCACTGTGCGTTGTATG pLKO_005 3388 CDS 100% 10.800 7.560 N FBXW7 n/a
10 TRCN0000006556 CCAGAGAAATTGCTTGCTTTA pLKO.1 2746 CDS 100% 10.800 7.560 N FBXW7 n/a
11 TRCN0000355640 TGATACATCAATCCGTGTTTG pLKO_005 3684 CDS 100% 10.800 7.560 N FBXW7 n/a
12 TRCN0000235423 TGATGGCAGGAGGGTTGTTAG pLKO_005 3534 CDS 100% 10.800 7.560 N FBXW7 n/a
13 TRCN0000006558 CCAGAGACTGAAACCTGTCTA pLKO.1 3589 CDS 100% 4.950 3.465 N FBXW7 n/a
14 TRCN0000355644 CTAGAAAGGAACTGCAATAAT pLKO_005 4526 3UTR 100% 15.000 9.000 N FBXW7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024454123.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03574 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03574 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477223 TGTCTGGTCTCAACTGTCAGACCT pLX_317 21.4% 100% 100% V5 n/a
Download CSV