Transcript: Human XM_024454392.1

PREDICTED: Homo sapiens EBF transcription factor 1 (EBF1), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EBF1 (1879)
Length:
7599
CDS:
1417..2805

Additional Resources:

NCBI RefSeq record:
XM_024454392.1
NBCI Gene record:
EBF1 (1879)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024454392.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421835 ACGAACCCACCATCGATTATG pLKO_005 2036 CDS 100% 13.200 18.480 N EBF1 n/a
2 TRCN0000412993 ACATGGTCTCAGCCGTGAAAC pLKO_005 2633 CDS 100% 10.800 15.120 N EBF1 n/a
3 TRCN0000013832 GCCATAGTGTATGAAGGCCAA pLKO.1 1429 CDS 100% 2.160 3.024 N EBF1 n/a
4 TRCN0000321382 GATGGGTTACAGGTCATATTC pLKO_005 1858 CDS 100% 13.200 10.560 N Ebf1 n/a
5 TRCN0000435286 GATGGGTTACAGGTCATATTC pLKO_005 1858 CDS 100% 13.200 10.560 N EBF1 n/a
6 TRCN0000013829 CCCTCAGATCCAGTGATAATT pLKO.1 1546 CDS 100% 15.000 10.500 N EBF1 n/a
7 TRCN0000321454 AGAGGTTACAGAAGGTCATTC pLKO_005 2063 CDS 100% 10.800 7.560 N Ebf1 n/a
8 TRCN0000086580 CCTGGCAGTCTCTGATAACAT pLKO.1 1692 CDS 100% 5.625 3.938 N Ebf1 n/a
9 TRCN0000013831 GCAGTCTCTGATAACATGTTT pLKO.1 1696 CDS 100% 5.625 3.938 N EBF1 n/a
10 TRCN0000086582 CCAGAGGTTACAGAAGGTCAT pLKO.1 2061 CDS 100% 4.050 2.835 N Ebf1 n/a
11 TRCN0000013830 GCAGGGATGATGGGCGTGAAT pLKO.1 2284 CDS 100% 1.650 1.155 N EBF1 n/a
12 TRCN0000424873 GTGCGACTGTGATCATCATAG pLKO_005 1823 CDS 100% 10.800 6.480 N EBF1 n/a
13 TRCN0000140536 GCCAACATGGTGAAACCTCAT pLKO.1 5186 3UTR 100% 4.050 2.025 Y TLCD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024454392.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00472 pDONR223 100% 73.7% 72.8% None (many diffs) n/a
2 TRCN0000470042 CCGTCATAAGGGACACTGTAAAAG pLX_317 26.1% 73.7% 72.8% V5 (many diffs) n/a
3 ccsbBroad304_00472 pLX_304 37.5% 73.6% 38.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV