Transcript: Mouse XM_030247076.1

PREDICTED: Mus musculus casein kinase 2, alpha 1 polypeptide (Csnk2a1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Csnk2a1 (12995)
Length:
4177
CDS:
230..1405

Additional Resources:

NCBI RefSeq record:
XM_030247076.1
NBCI Gene record:
Csnk2a1 (12995)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030247076.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222205 CCGAGTTGCTTCTCGATATTT pLKO.1 799 CDS 100% 15.000 21.000 N Csnk2a1 n/a
2 TRCN0000027627 GCCATCAACATCACAAATAAT pLKO.1 395 CDS 100% 15.000 21.000 N LOC245355 n/a
3 TRCN0000361110 TCCGAGTTGCTTCTCGATATT pLKO_005 798 CDS 100% 13.200 18.480 N Csnk2a1 n/a
4 TRCN0000222206 ACAGACTATGACATTCGATTT pLKO.1 614 CDS 100% 10.800 15.120 N Csnk2a1 n/a
5 TRCN0000361111 GCAATTGTACCAGACGTTAAC pLKO_005 595 CDS 100% 10.800 15.120 N Csnk2a1 n/a
6 TRCN0000195296 CGATTATAGTTTGGATATGTG pLKO.1 856 CDS 100% 4.950 3.960 N CSNK2A1 n/a
7 TRCN0000222204 GCCAATATGATGTCAGGGATT pLKO.1 1274 CDS 100% 4.050 3.240 N Csnk2a1 n/a
8 TRCN0000320928 ATTACCTGCAGGTGGAATATT pLKO_005 1661 3UTR 100% 15.000 10.500 N CSNK2A1 n/a
9 TRCN0000361116 ACCTGTCAGCAGCGCCAATAT pLKO_005 1261 CDS 100% 13.200 9.240 N Csnk2a1 n/a
10 TRCN0000222208 CAACACAGACTTCAAGCAATT pLKO.1 580 CDS 100% 10.800 7.560 N Csnk2a1 n/a
11 TRCN0000222207 CTGGACAAGCTGCTTCGATAT pLKO.1 1130 CDS 100% 10.800 7.560 N Csnk2a1 n/a
12 TRCN0000350294 TGGAATATTTCATGGACAAAT pLKO_005 1673 3UTR 100% 13.200 7.920 N CSNK2A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030247076.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00381 pDONR223 100% 94.5% 98.7% None (many diffs) n/a
2 ccsbBroad304_00381 pLX_304 0% 94.5% 98.7% V5 (many diffs) n/a
3 TRCN0000481421 CCAGCAGAGCACTACACAGTGGCT pLX_317 38.4% 94.5% 98.7% V5 (many diffs) n/a
4 ccsbBroadEn_14604 pDONR223 0% 94.5% 98.7% None (many diffs) n/a
5 ccsbBroad304_14604 pLX_304 0% 94.5% 98.7% V5 (many diffs) n/a
6 TRCN0000475347 TATACTCCTGATCCTGCACCAGTC pLX_317 45% 94.5% 98.7% V5 (many diffs) n/a
7 TRCN0000489332 CTTAAACCGTTGGGACCTTGAGCT pLX_317 30.6% 94.5% 98.7% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000491260 AAACCCATAGATCGAGCTTCCTTG pLX_317 25.2% 94.5% 98.7% V5 (not translated due to prior stop codon) (many diffs) n/a
9 TRCN0000489503 CGTCCTCGAGGCTAAGACATGATA pLX_317 37.1% 94.4% 98.4% V5 (many diffs) n/a
Download CSV