Transcript: Human XR_001738846.2

PREDICTED: Homo sapiens protein kinase C epsilon (PRKCE), transcript variant X21, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRKCE (5581)
Length:
10696
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001738846.2
NBCI Gene record:
PRKCE (5581)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001738846.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000846 CCACAAGTTCGGTATCCACAA pLKO.1 1512 3UTR 100% 4.050 5.670 N PRKCE n/a
2 TRCN0000219725 ATATGCTGTGAAGGTCTTAAA pLKO.1 2113 3UTR 100% 13.200 9.240 N PRKCE n/a
3 TRCN0000000844 GCAGAACTCAAGGGCAAAGAT pLKO.1 2087 3UTR 100% 5.625 3.938 N PRKCE n/a
4 TRCN0000197016 GCCTGGATGAGTTCAACTTCA pLKO.1 1997 3UTR 100% 4.950 3.465 N PRKCE n/a
5 TRCN0000000847 TGTCATAGGAAAGCAGGGATA pLKO.1 1362 3UTR 100% 4.050 2.835 N PRKCE n/a
6 TRCN0000000848 GCCAGAAGGAAGAGTGTATGT pLKO.1 1146 3UTR 100% 4.950 2.970 N PRKCE n/a
7 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 8381 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001738846.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01283 pDONR223 100% 18% None (many diffs) n/a
2 ccsbBroad304_01283 pLX_304 27.1% 18% V5 (many diffs) n/a
3 TRCN0000465452 ACTCTCTGTTATTACCTATAAACG pLX_317 16.2% 18% V5 (many diffs) n/a
4 TRCN0000488382 TGAAGTTGTTGTTCGTTGGTGCGC pLX_317 14.9% 18% V5 (many diffs) n/a
5 TRCN0000488914 TCCGATTCCCGCTAGAGTGGAAAG pLX_317 14.9% 18% V5 (many diffs) n/a
6 TRCN0000488864 CGGTCTTCAACTTCCCTTTTGGCA pLX_317 16.3% 18% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000489143 GCAGAAAACAATTTGCACCACATC pLX_317 16.3% 18% V5 (not translated due to prior stop codon) (many diffs) n/a
8 ccsbBroadEn_14790 pDONR223 64.8% 17.8% None (many diffs) n/a
9 ccsbBroad304_14790 pLX_304 30.6% 17.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV