Transcript: Human XR_001740206.1

PREDICTED: Homo sapiens protein kinase C iota (PRKCI), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRKCI (5584)
Length:
4722
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001740206.1
NBCI Gene record:
PRKCI (5584)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001740206.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219728 CTTCATGAGCGAGGGATAATT pLKO.1 1270 3UTR 100% 15.000 21.000 N PRKCI n/a
2 TRCN0000022755 CGAGGGATAATTTATAGAGAT pLKO.1 1279 3UTR 100% 4.950 6.930 N Prkci n/a
3 TRCN0000278130 CGAGGGATAATTTATAGAGAT pLKO_005 1279 3UTR 100% 4.950 6.930 N Prkci n/a
4 TRCN0000219727 AGTACTGTTGGTTCGATTAAA pLKO.1 966 3UTR 100% 15.000 12.000 N PRKCI n/a
5 TRCN0000333005 AGTACTGTTGGTTCGATTAAA pLKO_005 966 3UTR 100% 15.000 12.000 N PRKCI n/a
6 TRCN0000195501 CCATCTGCACAGACCGAATAT pLKO.1 629 3UTR 100% 13.200 10.560 N PRKCI n/a
7 TRCN0000220637 CCAAGGATATAAGTGCATCAA pLKO.1 663 3UTR 100% 4.950 3.960 N PRKCI n/a
8 TRCN0000220638 CCTGAAGAACATGCCAGATTT pLKO.1 1216 3UTR 100% 13.200 9.240 N PRKCI n/a
9 TRCN0000344667 CCTGAAGAACATGCCAGATTT pLKO_005 1216 3UTR 100% 13.200 9.240 N PRKCI n/a
10 TRCN0000196871 GCCATGCCAATTGTTCTTATA pLKO.1 4396 3UTR 100% 13.200 9.240 N PRKCI n/a
11 TRCN0000344616 GCCATGCCAATTGTTCTTATA pLKO_005 4396 3UTR 100% 13.200 9.240 N PRKCI n/a
12 TRCN0000195098 CAACTTTGATTCTCAGTTTAC pLKO.1 1727 3UTR 100% 10.800 7.560 N PRKCI n/a
13 TRCN0000220640 CCAGTCTAGGTCTTCAGGATT pLKO.1 905 3UTR 100% 4.950 3.465 N PRKCI n/a
14 TRCN0000344666 CCAGTCTAGGTCTTCAGGATT pLKO_005 905 3UTR 100% 4.950 3.465 N PRKCI n/a
15 TRCN0000220639 CCTTTAGACTTTATGAGCTAA pLKO.1 431 3UTR 100% 4.950 3.465 N PRKCI n/a
16 TRCN0000220636 GCCTGGATACAATTAACCATT pLKO.1 1934 3UTR 100% 4.950 3.465 N PRKCI n/a
17 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 2514 3UTR 100% 4.050 2.025 Y P3H4 n/a
18 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 2514 3UTR 100% 4.050 2.025 Y ORAI2 n/a
19 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 2514 3UTR 100% 4.050 2.025 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001740206.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492100 CGAACTACGAGCACTCCTTCAATT pLX_317 23.8% 34.7% V5 1_192del;1367_1368ins88;1866_4722delinsG n/a
2 TRCN0000488430 TTCCGAGGTATATATCCTAGTCCC pLX_317 21.4% 34.8% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000488985 GTATGCCGGGCTCAGTCACGTCTA pLX_317 20.9% 34.7% V5 1_192del;1367_1368ins88;1866_4722delinsG n/a
4 TRCN0000489076 TCTCCCTTAAGCAACTGGCTCAAG pLX_317 21.1% 34.7% V5 (not translated due to prior stop codon) 1_192del;1367_1368ins88;1866_4722del n/a
5 TRCN0000491894 ATATTCCACAGTCCAAGCCCTCGA pLX_317 23.9% 34.7% V5 (not translated due to prior stop codon) (many diffs) n/a
6 ccsbBroadEn_14793 pDONR223 0% 34.7% None (many diffs) n/a
7 ccsbBroad304_14793 pLX_304 0% 34.7% V5 (many diffs) n/a
8 TRCN0000471245 CAGAAAGATACCCGGATTTTGCCA pLX_317 24.1% 34.6% V5 (many diffs) n/a
Download CSV