Transcript: Human XR_001746996.1

PREDICTED: Homo sapiens nebulette (NEBL), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NEBL (10529)
Length:
3185
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001746996.1
NBCI Gene record:
NEBL (10529)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001746996.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430108 CATTAGCGATATCCGTTATAA pLKO_005 459 3UTR 100% 15.000 21.000 N NEBL n/a
2 TRCN0000432501 GCGAGTGAGAAAGACTATAAA pLKO_005 1756 3UTR 100% 15.000 21.000 N NEBL n/a
3 TRCN0000178768 CCATAGCAGATACTCCTGAAA pLKO.1 2033 3UTR 100% 4.950 6.930 N NEBL n/a
4 TRCN0000431629 ATCAGCAATCTCCAGTATAAA pLKO_005 2269 3UTR 100% 15.000 10.500 N NEBL n/a
5 TRCN0000146266 CATAGCAGATACTCCTGAAAT pLKO.1 2034 3UTR 100% 13.200 9.240 N NEBL n/a
6 TRCN0000415517 TGGAACATCTGCACCATAAAG pLKO_005 1280 3UTR 100% 13.200 9.240 N NEBL n/a
7 TRCN0000436171 GACTGACAGTCCTATGCTAAA pLKO_005 519 3UTR 100% 10.800 7.560 N NEBL n/a
8 TRCN0000183099 CTGACCTTTCTAATTCTCTTT pLKO.1 599 3UTR 100% 4.950 2.970 N NEBL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001746996.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07628 pDONR223 100% 69.7% None (many diffs) n/a
2 ccsbBroad304_07628 pLX_304 0% 69.7% V5 (many diffs) n/a
3 ccsbBroadEn_11516 pDONR223 100% 66.7% None (many diffs) n/a
4 ccsbBroad304_11516 pLX_304 0% 66.7% V5 (many diffs) n/a
5 TRCN0000476231 TCCGTGCGGCCCGACTGCAAGGGG pLX_317 19.6% 66.7% V5 (many diffs) n/a
Download CSV