Transcript: Human XR_001750200.2

PREDICTED: Homo sapiens phosphofurin acidic cluster sorting protein 2 (PACS2), transcript variant X12, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PACS2 (23241)
Length:
6383
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001750200.2
NBCI Gene record:
PACS2 (23241)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001750200.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000168619 GCAACAGAACTTCAAGCAGAA pLKO.1 800 3UTR 100% 4.050 5.670 N PACS2 n/a
2 TRCN0000136046 GATTGTAAGAACGACGTCCAT pLKO.1 773 3UTR 100% 2.640 3.696 N PACS2 n/a
3 TRCN0000134533 GAAGAACAAGAAGGTGATGTT pLKO.1 2662 3UTR 100% 4.950 3.465 N PACS2 n/a
4 TRCN0000137443 GACCAGGCAACAGAACTTCAA pLKO.1 794 3UTR 100% 4.950 3.465 N PACS2 n/a
5 TRCN0000135103 CACCAAGGAGAAGAACAAGAA pLKO.1 2653 3UTR 100% 4.950 2.475 Y PACS2 n/a
6 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 4959 3UTR 100% 4.950 2.475 Y LOC387873 n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4996 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000157610 GTGGCATGATCTCAGCTCATT pLKO.1 4793 3UTR 100% 4.950 2.475 Y CCNJL n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4996 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001750200.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10792 pDONR223 100% 3.4% None (many diffs) n/a
2 ccsbBroad304_10792 pLX_304 0% 3.4% V5 (many diffs) n/a
3 TRCN0000472287 GCCTGGAGAGCTTTCCTCGTCACG pLX_317 100% 3.4% V5 (many diffs) n/a
4 ccsbBroadEn_12783 pDONR223 100% 2.9% None (many diffs) n/a
5 ccsbBroad304_12783 pLX_304 0% 2.9% V5 (many diffs) n/a
6 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 2.9% V5 (many diffs) n/a
7 ccsbBroadEn_11616 pDONR223 100% 2.6% None (many diffs) n/a
8 ccsbBroad304_11616 pLX_304 0% 2.6% V5 (many diffs) n/a
9 TRCN0000467678 CCTCCCCTCACACCTCGTCAAAAC pLX_317 100% 2.6% V5 (many diffs) n/a
10 ccsbBroadEn_15487 pDONR223 0% 2.5% None (many diffs) n/a
11 ccsbBroad304_15487 pLX_304 0% 2.5% V5 (many diffs) n/a
12 TRCN0000473708 TAGCATCGTTGCACGCGCACGTTG pLX_317 100% 2.5% V5 (many diffs) n/a
13 ccsbBroadEn_10261 pDONR223 100% .9% None (many diffs) n/a
14 ccsbBroad304_10261 pLX_304 0% .9% V5 (many diffs) n/a
15 TRCN0000492083 TTATAGGCCCAGAGCACTACCAAC pLX_317 100% .9% V5 (many diffs) n/a
Download CSV