Transcript: Human XR_001750406.2

PREDICTED: Homo sapiens MIS18 binding protein 1 (MIS18BP1), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MIS18BP1 (55320)
Length:
7314
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001750406.2
NBCI Gene record:
MIS18BP1 (55320)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001750406.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017672 CCGTGACATAAGGAAATCAAT pLKO.1 1760 3UTR 100% 5.625 7.875 N MIS18BP1 n/a
2 TRCN0000017669 GCGATGAACGTGACTTACTTA pLKO.1 2407 3UTR 100% 5.625 7.875 N MIS18BP1 n/a
3 TRCN0000017668 CGTCAAAGAAACTCTTCAGAA pLKO.1 2780 3UTR 100% 4.950 3.960 N MIS18BP1 n/a
4 TRCN0000017670 GCACAACAAACTTAGGACTAT pLKO.1 1535 3UTR 100% 4.950 3.960 N MIS18BP1 n/a
5 TRCN0000435490 TGAGACTCTCAGTACTAATTG pLKO_005 1121 3UTR 100% 13.200 9.240 N MIS18BP1 n/a
6 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 5164 3UTR 100% 4.950 2.475 Y CFLAR n/a
7 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 5164 3UTR 100% 4.950 2.475 Y C19orf31 n/a
8 TRCN0000017671 GCTAGGTTCTATAAATAGGAA pLKO.1 3379 3UTR 100% 3.000 4.200 N MIS18BP1 n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4178 3UTR 100% 13.200 6.600 Y LIAS n/a
10 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 5162 3UTR 100% 4.950 2.475 Y ERN2 n/a
11 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 5162 3UTR 100% 4.950 2.475 Y P3H4 n/a
12 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 5162 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001750406.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08516 pDONR223 100% 44.6% None (many diffs) n/a
2 ccsbBroad304_08516 pLX_304 0% 44.6% V5 (many diffs) n/a
3 TRCN0000479353 TTCGTCTGATTAGCCACAGTGCCA pLX_317 15.7% 44.6% V5 (many diffs) n/a
4 ccsbBroadEn_10261 pDONR223 100% .8% None (many diffs) n/a
5 ccsbBroad304_10261 pLX_304 0% .8% V5 (many diffs) n/a
6 TRCN0000492083 TTATAGGCCCAGAGCACTACCAAC pLX_317 100% .8% V5 (many diffs) n/a
Download CSV