Transcript: Human XR_001752442.2

PREDICTED: Homo sapiens dishevelled segment polarity protein 2 (DVL2), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DVL2 (1856)
Length:
3083
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001752442.2
NBCI Gene record:
DVL2 (1856)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001752442.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303996 AGCGTCACAGATTCCACAATG pLKO_005 1045 3UTR 100% 10.800 15.120 N DVL2 n/a
2 TRCN0000097189 GCTGCCTTTGTTACTCTATTT pLKO.1 3013 3UTR 100% 13.200 9.240 N Dvl2 n/a
3 TRCN0000303995 GCTGCCTTTGTTACTCTATTT pLKO_005 3013 3UTR 100% 13.200 9.240 N DVL2 n/a
4 TRCN0000304003 GCCCACTTTCTCCTACCAATA pLKO_005 1992 3UTR 100% 10.800 7.560 N DVL2 n/a
5 TRCN0000033339 CACGCTAAACATGGAGAAGTA pLKO.1 1086 3UTR 100% 4.950 3.465 N DVL2 n/a
6 TRCN0000033341 GAGACAGAAACCGAGTCAGTA pLKO.1 730 3UTR 100% 4.950 3.465 N DVL2 n/a
7 TRCN0000300447 GAGACAGAAACCGAGTCAGTA pLKO_005 730 3UTR 100% 4.950 3.465 N DVL2 n/a
8 TRCN0000033343 GCACCATTACATCTGGATCGT pLKO.1 1481 3UTR 100% 2.640 1.848 N DVL2 n/a
9 TRCN0000033340 CTAGTCAACCTGTCTCTCAAT pLKO.1 1894 3UTR 100% 0.000 0.000 N DVL2 n/a
10 TRCN0000300446 CTAGTCAACCTGTCTCTCAAT pLKO_005 1894 3UTR 100% 0.000 0.000 N DVL2 n/a
11 TRCN0000033342 GCGAGTTCTTTGTGGATGTTA pLKO.1 2534 3UTR 100% 5.625 3.375 N DVL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001752442.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00470 pDONR223 100% 71.6% None 1_282del;1826_1891del;2557_3083del n/a
2 TRCN0000468133 AAGAGGTCGAGTGTGCGTATGTTC pLX_317 18.1% 71.6% V5 1_282del;1826_1891del;2557_3083del n/a
3 ccsbBroad304_00470 pLX_304 35.3% 58.5% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000489634 TACGATAGGAAGGGGGCTCTCGTC pLX_317 14.8% 71.6% V5 (not translated due to prior stop codon) 1_282del;1826_1891del;2557_3083del n/a
Download CSV