Transcript: Human XR_001753132.2

PREDICTED: Homo sapiens uncharacterized LOC105371942 (LOC105371942), ncRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC105371942 (105371942)
Length:
2219
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001753132.2
NBCI Gene record:
LOC105371942 (105371942)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001753132.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2162 3UTR 100% 4.950 2.475 Y ERAP2 n/a
2 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2163 3UTR 100% 13.200 6.600 Y LIAS n/a
3 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 71 3UTR 100% 5.625 2.813 Y KLHL30 n/a
4 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 71 3UTR 100% 5.625 2.813 Y EID2B n/a
5 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 2201 3UTR 100% 4.050 2.025 Y P3H4 n/a
6 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 2201 3UTR 100% 4.050 2.025 Y ORAI2 n/a
7 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 2201 3UTR 100% 4.050 2.025 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001753132.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000472111 CCAGACCCTGCGCAATTGAGCCTG pLX_317 100% 2.7% V5 (many diffs) n/a
2 ccsbBroadEn_10643 pDONR223 100% 2.6% None (many diffs) n/a
3 ccsbBroad304_10643 pLX_304 0% 2.6% V5 (many diffs) n/a
Download CSV