Transcript: Human XR_001755696.1

PREDICTED: Homo sapiens phosphorylase kinase regulatory subunit alpha 1 (PHKA1), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PHKA1 (5255)
Length:
6790
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001755696.1
NBCI Gene record:
PHKA1 (5255)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001755696.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194762 CAAGCTGATATCCTCTATATG pLKO.1 2478 3UTR 100% 13.200 18.480 N PHKA1 n/a
2 TRCN0000197239 GCAAACAACCTGCGACTTAAT pLKO.1 2222 3UTR 100% 13.200 18.480 N PHKA1 n/a
3 TRCN0000196868 GTGATGAAGTTGCTCGTTATT pLKO.1 2113 3UTR 100% 13.200 18.480 N PHKA1 n/a
4 TRCN0000322015 GTTCGTCCCACTGATTCAAAT pLKO_005 3060 3UTR 100% 13.200 18.480 N Phka1 n/a
5 TRCN0000342713 GTTCGTCCCACTGATTCAAAT pLKO_005 3060 3UTR 100% 13.200 18.480 N PHKA1 n/a
6 TRCN0000006188 GCTATTTCTATCCACGAGATT pLKO.1 3090 3UTR 100% 4.950 6.930 N PHKA1 n/a
7 TRCN0000199840 CGGTTGATTGTGCATGGAACT pLKO.1 4653 3UTR 100% 4.050 5.670 N PHKA1 n/a
8 TRCN0000342703 CGGTTGATTGTGCATGGAACT pLKO_005 4653 3UTR 100% 4.050 5.670 N PHKA1 n/a
9 TRCN0000006190 GCTCGTTATTTAGATCACCTT pLKO.1 2124 3UTR 100% 2.640 3.696 N PHKA1 n/a
10 TRCN0000196578 GTTATTGCCTAATCACTCCAA pLKO.1 4679 3UTR 100% 2.640 3.696 N PHKA1 n/a
11 TRCN0000342773 GTTATTGCCTAATCACTCCAA pLKO_005 4679 3UTR 100% 2.640 3.696 N PHKA1 n/a
12 TRCN0000342774 TGATGAAGTTGCTCGTTATTT pLKO_005 2114 3UTR 100% 15.000 10.500 N PHKA1 n/a
13 TRCN0000199322 CCAGCCTAGGATGCAACAATA pLKO.1 1594 3UTR 100% 13.200 9.240 N PHKA1 n/a
14 TRCN0000199049 CCAGCTGAGCTGAAGCTATTT pLKO.1 1086 3UTR 100% 13.200 9.240 N PHKA1 n/a
15 TRCN0000342702 CCAGCTGAGCTGAAGCTATTT pLKO_005 1086 3UTR 100% 13.200 9.240 N PHKA1 n/a
16 TRCN0000199346 CTCACCATGCTGGCAGATATT pLKO.1 4330 3UTR 100% 13.200 9.240 N PHKA1 n/a
17 TRCN0000052610 CCTGCTCTTCTTAGCCCAAAT pLKO.1 566 3UTR 100% 10.800 7.560 N PHKA1P1 n/a
18 TRCN0000199512 GCACTGCCAGTCTATCCTAAA pLKO.1 851 3UTR 100% 10.800 7.560 N PHKA1 n/a
19 TRCN0000196619 GTAGAAGAAGTGAACACTTAC pLKO.1 4762 3UTR 100% 10.800 7.560 N PHKA1 n/a
20 TRCN0000025071 GCCATTGTTCTGGACATACTT pLKO.1 1127 3UTR 100% 5.625 3.938 N Phka1 n/a
21 TRCN0000322011 GCCATTGTTCTGGACATACTT pLKO_005 1127 3UTR 100% 5.625 3.938 N Phka1 n/a
22 TRCN0000006187 CCAGTGACAATCTTATGAGTA pLKO.1 4804 3UTR 100% 4.950 3.465 N PHKA1 n/a
23 TRCN0000052609 CCTTCAAATATAGTCAGAGTA pLKO.1 445 3UTR 100% 4.950 3.465 N PHKA1P1 n/a
24 TRCN0000052612 GCAGAGTGTAGTGAAGCTGAT pLKO.1 377 3UTR 100% 4.050 2.835 N PHKA1P1 n/a
25 TRCN0000006189 CCACAGTTTATAGACCAGCAA pLKO.1 1707 3UTR 100% 2.640 1.848 N PHKA1 n/a
26 TRCN0000052611 CCATGCAAAGTACAACACCAA pLKO.1 479 3UTR 100% 2.640 1.848 N PHKA1P1 n/a
27 TRCN0000006191 GCCTGATGAATCTCAGTCCTT pLKO.1 2977 3UTR 100% 2.640 1.848 N PHKA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001755696.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14751 pDONR223 44.5% 53.2% None (many diffs) n/a
2 ccsbBroad304_14751 pLX_304 0% 53.2% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000468045 TGTTCTGACCCCTTACGGAGCCAC pLX_317 8.8% 53.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV