Transcript: Human XR_002956633.1

PREDICTED: Homo sapiens ATPase H+ transporting V1 subunit B2 (ATP6V1B2), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATP6V1B2 (526)
Length:
9311
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002956633.1
NBCI Gene record:
ATP6V1B2 (526)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002956633.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029544 GCCCTCACTATCACGGTTAAT pLKO.1 3129 3UTR 100% 13.200 18.480 N ATP6V1B2 n/a
2 TRCN0000322746 GCCCTCACTATCACGGTTAAT pLKO_005 3129 3UTR 100% 13.200 18.480 N ATP6V1B2 n/a
3 TRCN0000322816 CATAGTGGAGTAGTTAGTTAC pLKO_005 3747 3UTR 100% 10.800 15.120 N ATP6V1B2 n/a
4 TRCN0000029546 CCGATGTATCTAACCAGCTAT pLKO.1 3191 3UTR 100% 4.950 6.930 N ATP6V1B2 n/a
5 TRCN0000322880 CCGATGTATCTAACCAGCTAT pLKO_005 3191 3UTR 100% 4.950 6.930 N ATP6V1B2 n/a
6 TRCN0000029547 CCGGTTCTTCAAATCTGACTT pLKO.1 755 3UTR 100% 4.950 3.465 N ATP6V1B2 n/a
7 TRCN0000322814 CCGGTTCTTCAAATCTGACTT pLKO_005 755 3UTR 100% 4.950 3.465 N ATP6V1B2 n/a
8 TRCN0000029545 CGCCTCACATACAAGACAGTA pLKO.1 162 3UTR 100% 4.950 3.465 N ATP6V1B2 n/a
9 TRCN0000029548 GCTGAATTTCTGGCGTACCAA pLKO.1 876 3UTR 100% 3.000 1.800 N ATP6V1B2 n/a
10 TRCN0000350699 GCTGAATTTCTGGCGTACCAA pLKO_005 876 3UTR 100% 3.000 1.800 N ATP6V1B2 n/a
11 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 8561 3UTR 100% 4.950 2.475 Y LOC387873 n/a
12 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 9130 3UTR 100% 1.080 0.540 Y GPR83 n/a
13 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 9130 3UTR 100% 1.080 0.540 Y MYORG n/a
14 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 8598 3UTR 100% 5.625 2.813 Y KLHL30 n/a
15 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 8598 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002956633.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00134 pDONR223 100% 16.4% None 1_32del;958_2869del;3478_9311del n/a
2 ccsbBroad304_00134 pLX_304 0% 16.4% V5 1_32del;958_2869del;3478_9311del n/a
3 TRCN0000473950 ATAAGACTCTCGACTATAATACGG pLX_317 28.3% 16.4% V5 1_32del;958_2869del;3478_9311del n/a
4 ccsbBroadEn_05873 pDONR223 100% 16.4% None (many diffs) n/a
5 ccsbBroad304_05873 pLX_304 0% 16.4% V5 (many diffs) n/a
6 TRCN0000466226 ATCAGTCGAGCGAATATAACCAGT pLX_317 26.9% 16.4% V5 (many diffs) n/a
7 ccsbBroadEn_12783 pDONR223 100% 2% None (many diffs) n/a
8 ccsbBroad304_12783 pLX_304 0% 2% V5 (many diffs) n/a
9 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 2% V5 (many diffs) n/a
10 ccsbBroadEn_15487 pDONR223 0% 1.7% None (many diffs) n/a
11 ccsbBroad304_15487 pLX_304 0% 1.7% V5 (many diffs) n/a
12 TRCN0000473708 TAGCATCGTTGCACGCGCACGTTG pLX_317 100% 1.7% V5 (many diffs) n/a
Download CSV