Transcript: Human XR_002957453.1

PREDICTED: Homo sapiens M-phase phosphoprotein 8 (MPHOSPH8), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MPHOSPH8 (54737)
Length:
4371
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002957453.1
NBCI Gene record:
MPHOSPH8 (54737)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002957453.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360126 GACATCGTACGACTCGTAATT pLKO_005 2142 3UTR 100% 13.200 18.480 N MPHOSPH8 n/a
2 TRCN0000085440 GCCAAGGTTAAGTTGCTAATA pLKO.1 2758 3UTR 100% 13.200 18.480 N Mphosph8 n/a
3 TRCN0000302162 GCCAAGGTTAAGTTGCTAATA pLKO_005 2758 3UTR 100% 13.200 18.480 N Mphosph8 n/a
4 TRCN0000360125 TTGCGAAGCAGTCTAACAATG pLKO_005 2218 3UTR 100% 10.800 15.120 N MPHOSPH8 n/a
5 TRCN0000117922 CCTCTTGCAGTTAAGCCTGTT pLKO.1 2913 3UTR 100% 4.050 5.670 N MPHOSPH8 n/a
6 TRCN0000117926 GCTAGAGAACAAGAACGCTTT pLKO.1 1139 3UTR 100% 4.050 5.670 N MPHOSPH8 n/a
7 TRCN0000367937 CAGTGTCCAGACTGCGTATTT pLKO_005 2997 3UTR 100% 13.200 9.240 N MPHOSPH8 n/a
8 TRCN0000360127 TGGAGTAGTGGGCGAAGATAA pLKO_005 194 3UTR 100% 13.200 9.240 N MPHOSPH8 n/a
9 TRCN0000117925 CAAGCTGTAGTTCTGAATGAT pLKO.1 2514 3UTR 100% 5.625 3.938 N MPHOSPH8 n/a
10 TRCN0000117924 GCTTCTTGAATTTAGGAAGAA pLKO.1 407 3UTR 100% 0.495 0.347 N MPHOSPH8 n/a
11 TRCN0000117923 GCTGTTTATCTTCCATGCAAA pLKO.1 2444 3UTR 100% 4.950 2.970 N MPHOSPH8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002957453.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10792 pDONR223 100% 4.9% None (many diffs) n/a
2 ccsbBroad304_10792 pLX_304 0% 4.9% V5 (many diffs) n/a
3 TRCN0000472287 GCCTGGAGAGCTTTCCTCGTCACG pLX_317 100% 4.9% V5 (many diffs) n/a
4 ccsbBroadEn_10261 pDONR223 100% 1.5% None (many diffs) n/a
5 ccsbBroad304_10261 pLX_304 0% 1.5% V5 (many diffs) n/a
6 TRCN0000492083 TTATAGGCCCAGAGCACTACCAAC pLX_317 100% 1.5% V5 (many diffs) n/a
Download CSV