Transcript: Human XR_002957641.1

PREDICTED: Homo sapiens Meis homeobox 2 (MEIS2), transcript variant X15, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MEIS2 (4212)
Length:
2967
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002957641.1
NBCI Gene record:
MEIS2 (4212)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002957641.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274056 CCCACACCCTACTCAATTAAG pLKO_005 1625 3UTR 100% 13.200 18.480 N MEIS2 n/a
2 TRCN0000016046 CCACAAATCTCGCTGACCATA pLKO.1 1008 3UTR 100% 4.950 6.930 N MEIS2 n/a
3 TRCN0000016043 CGGCCTTTGTTCCTCCATAAA pLKO.1 2365 3UTR 100% 13.200 10.560 N MEIS2 n/a
4 TRCN0000274057 TCTATGGGCACCCGTTGTTTC pLKO_005 627 3UTR 100% 10.800 8.640 N MEIS2 n/a
5 TRCN0000310875 TCTATGGGCACCCGTTGTTTC pLKO_005 627 3UTR 100% 10.800 8.640 N Meis2 n/a
6 TRCN0000016044 CCCATGATTGACCAGTCAAAT pLKO.1 1320 3UTR 100% 13.200 9.240 N MEIS2 n/a
7 TRCN0000274060 CCCATGATTGACCAGTCAAAT pLKO_005 1320 3UTR 100% 13.200 9.240 N MEIS2 n/a
8 TRCN0000274058 GAGCCAAGGAGCAGCATATAG pLKO_005 1349 3UTR 100% 13.200 9.240 N MEIS2 n/a
9 TRCN0000274059 ACAAGCAATACAAGTACTAAG pLKO_005 832 3UTR 100% 10.800 7.560 N MEIS2 n/a
10 TRCN0000016045 CCACCGATACATTAGCTGTTT pLKO.1 904 3UTR 100% 4.950 3.465 N MEIS2 n/a
11 TRCN0000075590 CCCACAATGTTAAATTCTGTA pLKO.1 1755 3UTR 100% 4.950 3.465 N Meis2 n/a
12 TRCN0000301327 CCCACAATGTTAAATTCTGTA pLKO_005 1755 3UTR 100% 4.950 3.465 N Meis2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002957641.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00998 pDONR223 100% 43.6% None (many diffs) n/a
2 ccsbBroad304_00998 pLX_304 0% 43.6% V5 (many diffs) n/a
3 TRCN0000465719 ACTGCGGCTGATCAGATCCCCAGG pLX_317 23% 43.6% V5 (many diffs) n/a
4 ccsbBroadEn_00999 pDONR223 100% 35% None 1_427del;1288_1289ins77;1494_2967del n/a
5 ccsbBroad304_00999 pLX_304 0% 35% V5 1_427del;1288_1289ins77;1494_2967del n/a
6 TRCN0000470691 ACACACCCAATCGGACACGTGCAG pLX_317 35% 35% V5 1_427del;1288_1289ins77;1494_2967del n/a
Download CSV