Transcript: Human XR_002957735.1

PREDICTED: Homo sapiens vesicle-associated membrane protein-associated protein A pseudogene (LOC112268155), misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC112268155 (112268155)
Length:
5862
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002957735.1
NBCI Gene record:
LOC112268155 (112268155)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002957735.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093613 ACAGATGTAGTCACTACAAAT pLKO.1 271 3UTR 100% 13.200 6.600 Y Vapa n/a
2 TRCN0000317486 ACAGATGTAGTCACTACAAAT pLKO_005 271 3UTR 100% 13.200 6.600 Y Vapa n/a
3 TRCN0000341259 TGGATTCTTTCTAGGGAAATT pLKO_005 1191 3UTR 100% 13.200 6.600 Y Mospd4 n/a
4 TRCN0000382165 AGATTTGTTTACCTACCATTT pLKO_005 1269 3UTR 100% 10.800 5.400 Y Vapa n/a
5 TRCN0000029130 GCGAAATCCATCGGATAGAAA pLKO.1 300 3UTR 100% 5.625 2.813 Y VAPA n/a
6 TRCN0000293261 GCGAAATCCATCGGATAGAAA pLKO_005 300 3UTR 100% 5.625 2.813 Y VAPA n/a
7 TRCN0000029132 CTTGTTGTAATTGCAGCCATT pLKO.1 857 3UTR 100% 4.050 2.025 Y VAPA n/a
8 TRCN0000029131 GCCCTTTGACTATGATCCGAA pLKO.1 426 3UTR 100% 2.640 1.320 Y VAPA n/a
9 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 978 3UTR 100% 4.950 2.475 Y C16orf89 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002957735.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11349 pDONR223 100% 11.2% None (many diffs) n/a
2 ccsbBroad304_11349 pLX_304 0% 11.2% V5 (many diffs) n/a
3 TRCN0000492044 ATTCCAACAAAGTTCTAGCTCCCC pLX_317 56.1% 11.2% V5 (many diffs) n/a
4 ccsbBroadEn_12783 pDONR223 100% 3.1% None (many diffs) n/a
5 ccsbBroad304_12783 pLX_304 0% 3.1% V5 (many diffs) n/a
6 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 3.1% V5 (many diffs) n/a
7 ccsbBroadEn_11616 pDONR223 100% 3% None (many diffs) n/a
8 ccsbBroad304_11616 pLX_304 0% 3% V5 (many diffs) n/a
9 TRCN0000467678 CCTCCCCTCACACCTCGTCAAAAC pLX_317 100% 3% V5 (many diffs) n/a
Download CSV