Transcript: Mouse XR_003953034.1

PREDICTED: Mus musculus pregnancy upregulated non-ubiquitously expressed CaM kinase (Pnck), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Pnck (93843)
Length:
1405
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_003953034.1
NBCI Gene record:
Pnck (93843)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_003953034.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000368818 ATCGCGGTACTTCGCAGAATC pLKO_005 284 3UTR 100% 10.800 15.120 N Pnck n/a
2 TRCN0000361894 AGGACATCAGCAGTGTCTATG pLKO_005 126 3UTR 100% 10.800 7.560 N Pnck n/a
3 TRCN0000361945 CGCTGTCTCCTACCTTCATAG pLKO_005 466 3UTR 100% 10.800 7.560 N Pnck n/a
4 TRCN0000361893 GCATTCAATGCCACATCATTC pLKO_005 922 3UTR 100% 10.800 7.560 N Pnck n/a
5 TRCN0000381077 ACATCTCAGAATCAGCCAAAG pLKO_005 737 3UTR 100% 6.000 4.200 N PNCK n/a
6 TRCN0000024395 CCTGAACTCTTCAGCCAGATT pLKO.1 676 3UTR 100% 4.950 3.465 N Pnck n/a
7 TRCN0000024397 GAGAATGAGATCGCGGTACTT pLKO.1 275 3UTR 100% 4.950 3.465 N Pnck n/a
8 TRCN0000024396 GTGCATTCAATGCCACATCAT pLKO.1 920 3UTR 100% 4.950 3.465 N Pnck n/a
9 TRCN0000024394 CCCTTCTATGATGAGAGCGAT pLKO.1 655 3UTR 100% 2.640 1.848 N Pnck n/a
10 TRCN0000024398 CGCCACCTTCTGGAACGTGAT pLKO.1 766 3UTR 100% 1.350 0.945 N Pnck n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_003953034.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491589 CTAAACCTTTCCAAATGAGTCACC pLX_317 86% 16.1% V5 (many diffs) n/a
2 ccsbBroadEn_13199 pDONR223 100% 16% None (many diffs) n/a
3 ccsbBroad304_13199 pLX_304 0% 16% V5 (many diffs) n/a
4 TRCN0000465807 GCCCCCCATACACAAGTGACTCCA pLX_317 55.3% 16% V5 (many diffs) n/a
5 ccsbBroadEn_15252 pDONR223 0% 16% None (many diffs) n/a
6 ccsbBroad304_15252 pLX_304 0% 16% V5 (many diffs) n/a
7 TRCN0000471652 TCGAAGAAAGCGAATCCCTTGCAG pLX_317 72.3% 16% V5 (many diffs) n/a
8 TRCN0000488639 GACCAGCTCATGTGGATGCGCCAA pLX_317 69.1% 16% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV