Transcript: Human XR_244083.3

PREDICTED: Homo sapiens small integral membrane protein 7 (SMIM7), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SMIM7 (79086)
Length:
1065
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_244083.3
NBCI Gene record:
SMIM7 (79086)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_244083.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000370238 ACAGGTGACAACATCCGGGAA pLKO_005 152 3UTR 100% 2.160 3.024 N SMIM7 n/a
2 TRCN0000343741 ATGATGTTCTGCATGATTGTG pLKO_005 227 3UTR 100% 4.950 3.465 N SMIM7 n/a
3 TRCN0000343740 CATCGCCCTGTGGAACATCTT pLKO_005 205 3UTR 100% 4.950 3.465 N SMIM7 n/a
4 TRCN0000167139 CCAATAAGAATGAGCCTGAAT pLKO.1 930 3UTR 100% 4.950 3.465 N SMIM7 n/a
5 TRCN0000168364 GAATCCCACAACTGTGTGATT pLKO.1 861 3UTR 100% 4.950 3.465 N SMIM7 n/a
6 TRCN0000168852 GCCTTCCTGTATAGACACTAA pLKO.1 491 3UTR 100% 4.950 3.465 N SMIM7 n/a
7 TRCN0000377528 CGGTGCTGAACTTTAAGCTGA pLKO_005 84 3UTR 100% 2.640 1.848 N SMIM7 n/a
8 TRCN0000377469 AGAAGGACACGCAGGGCTTTG pLKO_005 108 3UTR 100% 2.000 1.400 N SMIM7 n/a
9 TRCN0000166905 CATCTAGGAAATACAGCATTT pLKO.1 774 3UTR 100% 10.800 6.480 N SMIM7 n/a
10 TRCN0000343742 CTTGAATCCCAGCGATGAAAC pLKO_005 258 3UTR 100% 10.800 6.480 N SMIM7 n/a
11 TRCN0000343743 TGCTGAGCCTCAGATACTTTC pLKO_005 177 3UTR 100% 10.800 6.480 N SMIM7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_244083.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14257 pDONR223 100% 13.1% None (many diffs) n/a
2 ccsbBroad304_14257 pLX_304 0% 13.1% V5 (many diffs) n/a
3 TRCN0000474684 AGATGTAGTTGTAGGTTCGTCATG pLX_317 100% 13.1% V5 (many diffs) n/a
Download CSV