Transcript: Mouse XR_373251.2

PREDICTED: Mus musculus STE20-related kinase adaptor beta (Stradb), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stradb (227154)
Length:
2194
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_373251.2
NBCI Gene record:
Stradb (227154)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_373251.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025339 GCAGTGATTCTATCTCACTTT pLKO.1 738 3UTR 100% 0.495 0.693 N Stradb n/a
2 TRCN0000025340 GCCCACTGGATGTCAGTATTT pLKO.1 1107 3UTR 100% 13.200 9.240 N Stradb n/a
3 TRCN0000362168 TCGGTCCTGTTAGGTACAAAT pLKO_005 1562 3UTR 100% 13.200 9.240 N Stradb n/a
4 TRCN0000362165 AGCTCCTAAGGACCTACTTTC pLKO_005 856 3UTR 100% 10.800 7.560 N Stradb n/a
5 TRCN0000362167 TAAGCTGTGACTGGTACTTTC pLKO_005 1777 3UTR 100% 10.800 7.560 N Stradb n/a
6 TRCN0000007076 GCTTTGGGTTATTTCTCCATT pLKO.1 812 3UTR 100% 4.950 3.465 N STRADB n/a
7 TRCN0000025343 GCAAGCAGTTTGTTGTCCCAT pLKO.1 1325 3UTR 100% 2.640 1.848 N Stradb n/a
8 TRCN0000025341 GTATTCTTCAAGCAGATGAAA pLKO.1 1346 3UTR 100% 5.625 3.375 N Stradb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_373251.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08534 pDONR223 100% 40.6% None (many diffs) n/a
2 ccsbBroad304_08534 pLX_304 0% 40.6% V5 (many diffs) n/a
3 TRCN0000480011 CGACCGGTTCTTATGCTTCATGCA pLX_317 32.2% 40.6% V5 (many diffs) n/a
4 TRCN0000488545 CTCATACCTGATAGCGCAGGAGCC pLX_317 25.7% 40.6% V5 (many diffs) n/a
5 TRCN0000488001 GGGCTCAGCGAAGGCACAAATGGC pLX_317 25.8% 40.6% V5 (not translated due to prior stop codon) (many diffs) n/a
6 ccsbBroadEn_15321 pDONR223 100% 37.3% None (many diffs) n/a
7 TRCN0000466482 CTGGCTGCCAGCGCATTTACCTTT pLX_317 20.8% 37.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV