Transcript: Mouse XR_379412.3

PREDICTED: Mus musculus tropomyosin 1, alpha (Tpm1), transcript variant X15, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tpm1 (22003)
Length:
1412
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_379412.3
NBCI Gene record:
Tpm1 (22003)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_379412.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071536 GAAGATGCTGACCGGAAGTAT pLKO.1 675 3UTR 100% 5.625 7.875 N Tpm1 n/a
2 TRCN0000351719 GAAGATGCTGACCGGAAGTAT pLKO_005 675 3UTR 100% 5.625 7.875 N Tpm1 n/a
3 TRCN0000071537 CGGTGACGAACAACTTGAAGT pLKO.1 881 3UTR 100% 4.950 6.930 N Tpm1 n/a
4 TRCN0000351720 CGGTGACGAACAACTTGAAGT pLKO_005 881 3UTR 100% 4.950 6.930 N Tpm1 n/a
5 TRCN0000062150 GATCAGACCTTGAAAGCATTA pLKO.1 810 3UTR 100% 10.800 7.560 N TPM1 n/a
6 TRCN0000071535 AGCTGACGTAGCTTCTCTGAA pLKO.1 455 3UTR 100% 4.950 3.465 N Tpm1 n/a
7 TRCN0000351799 AGCTGACGTAGCTTCTCTGAA pLKO_005 455 3UTR 100% 4.950 3.465 N Tpm1 n/a
8 TRCN0000071534 GCAGAGAGATCAGTAACCAAA pLKO.1 1009 3UTR 100% 4.950 3.465 N Tpm1 n/a
9 TRCN0000062151 GCCCGTAAGCTGGTCATCATT pLKO.1 705 3UTR 100% 5.625 3.938 N TPM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_379412.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07090 pDONR223 100% 53.1% None (many diffs) n/a
2 ccsbBroad304_07090 pLX_304 0% 53.1% V5 (many diffs) n/a
3 TRCN0000492218 CAAACTCGTCTCTACCATCGTAAC pLX_317 61.1% 53.1% V5 (many diffs) n/a
4 ccsbBroadEn_07091 pDONR223 100% 45% None (many diffs) n/a
5 ccsbBroad304_07091 pLX_304 0% 45% V5 (many diffs) n/a
6 TRCN0000481549 GATCAAGGGTCTCTCCCCTACTAG pLX_317 63.1% 45% V5 (many diffs) n/a
Download CSV