Transcript: Mouse XR_388348.2

PREDICTED: Mus musculus glutamate receptor, ionotropic, AMPA1 (alpha 1) (Gria1), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gria1 (14799)
Length:
5898
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_388348.2
NBCI Gene record:
Gria1 (14799)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_388348.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103049 GCCGTTTCAGTCCTTATGAAT pLKO.1 2136 3UTR 100% 5.625 7.875 N Gria1 n/a
2 TRCN0000103046 CGCCCTGAGAAATCCAGTAAA pLKO.1 2725 3UTR 100% 13.200 10.560 N Gria1 n/a
3 TRCN0000353436 TAATCGAGTTCTGCTACAAAT pLKO_005 3052 3UTR 100% 13.200 10.560 N Gria1 n/a
4 TRCN0000103047 CGTCCAGAATAGAACCTACAT pLKO.1 1672 3UTR 100% 4.950 3.960 N Gria1 n/a
5 TRCN0000353435 ACAACCAGTGACCAGTCAAAT pLKO_005 2192 3UTR 100% 13.200 9.240 N Gria1 n/a
6 TRCN0000328816 CAAGGAAGTCTAACGTCTATA pLKO_005 3575 3UTR 100% 13.200 9.240 N Gria1 n/a
7 TRCN0000328815 CTGGCAAAGCAGACGGAAATT pLKO_005 2420 3UTR 100% 13.200 9.240 N Gria1 n/a
8 TRCN0000353468 GGAAGCTCTCATTAGCATTAT pLKO_005 853 3UTR 100% 13.200 9.240 N Gria1 n/a
9 TRCN0000061640 CCAGTAAACCTGGCAGTGTTA pLKO.1 2738 3UTR 100% 4.950 3.465 N GRIA1 n/a
10 TRCN0000103045 CCCAGAAAGAATACTACCTAA pLKO.1 3941 3UTR 100% 4.950 3.465 N Gria1 n/a
11 TRCN0000103048 GCGACAGCTTTGAGATGACTT pLKO.1 657 3UTR 100% 4.950 3.465 N Gria1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_388348.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06326 pDONR223 100% 41.6% None (many diffs) n/a
2 ccsbBroad304_06326 pLX_304 0% 41.6% V5 (many diffs) n/a
3 TRCN0000465270 CATAATTAAGGTCCATATACTGTT pLX_317 11.7% 41.6% V5 (many diffs) n/a
Download CSV