Transcript: Human XR_429586.2

PREDICTED: Homo sapiens golgin subfamily A member 6-like protein 4 (LOC102724117), misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC102724117 (102724117)
Length:
4417
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_429586.2
NBCI Gene record:
LOC102724117 (102724117)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_429586.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000269219 GGATTCAAGCTCCGCAATAAT pLKO_005 356 3UTR 100% 15.000 7.500 Y GOLGA6L9 n/a
2 TRCN0000283947 TTTACCCTGACACGTATAAAT pLKO_005 3491 3UTR 100% 15.000 7.500 Y GOLGA6L9 n/a
3 TRCN0000162932 GCAGTTGGAGCAGCAAGTAAA pLKO.1 1378 3UTR 100% 13.200 6.600 Y GOLGA8B n/a
4 TRCN0000269218 CAGTTGGAGCAGCAAGTAAAG pLKO_005 1379 3UTR 100% 10.800 5.400 Y GOLGA6L9 n/a
5 TRCN0000150250 GAGAAGAAGCATGAGATACAT pLKO.1 426 3UTR 100% 5.625 2.813 Y GOLGA6L5P n/a
6 TRCN0000180631 GAGGTGGAGAAGCTGTTAGAA pLKO.1 908 3UTR 100% 5.625 2.813 Y GOLGA6L9 n/a
7 TRCN0000180938 GAAGAGGTGGAGAAGCTGTTA pLKO.1 905 3UTR 100% 4.950 2.475 Y GOLGA6L5P n/a
8 TRCN0000179455 GAGGAGAAGAAGCATGAGATA pLKO.1 423 3UTR 100% 4.950 2.475 Y GOLGA6L5P n/a
9 TRCN0000149653 GAGGAGCTTGTTCAAACTCAA pLKO.1 464 3UTR 100% 4.950 2.475 Y GOLGA6L5P n/a
10 TRCN0000153184 GTGGGAGTTCAAACACACAAA pLKO.1 1992 3UTR 100% 4.950 2.475 Y GOLGA8F n/a
11 TRCN0000149152 GCATGAGATACATCTGGTACA pLKO.1 434 3UTR 100% 4.050 2.025 Y GOLGA6L5P n/a
12 TRCN0000269223 AGAGGTGGAGAAGCTGTTAAA pLKO_005 907 3UTR 100% 13.200 6.600 Y GOLGA6L9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_429586.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15313 pDONR223 80.2% 23.7% None (many diffs) n/a
2 ccsbBroad304_15313 pLX_304 0% 23.7% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_13690 pDONR223 100% 18.4% None (many diffs) n/a
4 ccsbBroad304_13690 pLX_304 0% 18.4% V5 (many diffs) n/a
5 ccsbBroadEn_15348 pDONR223 64.5% 12.5% None (many diffs) n/a
6 ccsbBroad304_15348 pLX_304 0% 12.5% V5 (many diffs) n/a
7 TRCN0000473379 GCTTCCGCCGAACCGATGGAGCTC pLX_317 100% 7.4% V5 (many diffs) n/a
Download CSV