Transcript: Mouse XR_868764.2

PREDICTED: Mus musculus suppression of tumorigenicity 7 (St7), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
St7 (64213)
Length:
1917
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_868764.2
NBCI Gene record:
St7 (64213)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_868764.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249439 TTACCAAAGTCGGCGACAATA pLKO_005 1826 3UTR 100% 13.200 18.480 N St7 n/a
2 TRCN0000183751 CGGAATATAATCGGTACACTT pLKO.1 1291 3UTR 100% 4.950 6.930 N St7 n/a
3 TRCN0000249440 CCTTGGAGATAAACGAAATTA pLKO_005 1480 3UTR 100% 15.000 10.500 N St7 n/a
4 TRCN0000215948 CACCAATGTCTTAGTCTATAT pLKO.1 1727 3UTR 100% 13.200 9.240 N St7 n/a
5 TRCN0000249438 CACCAATGTCTTAGTCTATAT pLKO_005 1727 3UTR 100% 13.200 9.240 N St7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_868764.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07193 pDONR223 100% 36.8% None (many diffs) n/a
2 ccsbBroad304_07193 pLX_304 0% 36.8% V5 (many diffs) n/a
3 TRCN0000468200 TTACGAATGGATTTTAGCATAAAT pLX_317 21.8% 36.8% V5 (many diffs) n/a
4 ccsbBroadEn_11249 pDONR223 100% 33.7% None (many diffs) n/a
5 ccsbBroad304_11249 pLX_304 0% 33.7% V5 (many diffs) n/a
6 TRCN0000479746 TGGCTCGCTACCTCCTCGCAGCAC pLX_317 21.8% 33.7% V5 (many diffs) n/a
Download CSV