Transcript: Human XR_926215.3

PREDICTED: Homo sapiens male germ cell associated kinase (MAK), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAK (4117)
Length:
2310
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_926215.3
NBCI Gene record:
MAK (4117)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_926215.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001786 GATCCACTTAGCACCTCTCAA pLKO.1 2028 3UTR 100% 4.950 6.930 N MAK n/a
2 TRCN0000001787 CTCTATATGTTAAGGCCACTT pLKO.1 847 3UTR 100% 4.050 5.670 N MAK n/a
3 TRCN0000001788 CGTCAAATCATCTGGAATCAA pLKO.1 1148 3UTR 100% 5.625 4.500 N MAK n/a
4 TRCN0000001789 CAATGCCAGTAATGAAGCTAT pLKO.1 1023 3UTR 100% 4.950 3.465 N MAK n/a
5 TRCN0000194976 CCATCTTTAGTTGAGGTAGAG pLKO.1 1210 3UTR 100% 4.050 2.835 N MAK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_926215.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10956 pDONR223 100% 58.4% None (many diffs) n/a
2 ccsbBroad304_10956 pLX_304 0% 58.4% V5 (many diffs) n/a
3 TRCN0000469828 TCACTAAAAGCTTCGCAACATTTC pLX_317 30.1% 58.4% V5 (many diffs) n/a
4 ccsbBroadEn_14692 pDONR223 0% 58.4% None (many diffs) n/a
5 ccsbBroad304_14692 pLX_304 0% 58.4% V5 (many diffs) n/a
6 TRCN0000479982 CGCACAATGCGTTGACGATATGGT pLX_317 29.7% 58.4% V5 (many diffs) n/a
Download CSV