Transcript: Human XR_928308.1

PREDICTED: Homo sapiens t-SNARE domain containing 1 (TSNARE1), transcript variant X10, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TSNARE1 (203062)
Length:
2571
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_928308.1
NBCI Gene record:
TSNARE1 (203062)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_928308.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139680 CGAGTATGGAATCCGCCATTT pLKO.1 147 3UTR 100% 10.800 15.120 N TSNARE1 n/a
2 TRCN0000139991 GCTAGATGTTGGACCGAGTAT pLKO.1 133 3UTR 100% 4.950 6.930 N TSNARE1 n/a
3 TRCN0000139628 CCAACGTCTTCCGAATCAACT pLKO.1 836 3UTR 100% 4.950 3.960 N TSNARE1 n/a
4 TRCN0000139589 CAGGAGACCAACAAGACCATT pLKO.1 946 3UTR 100% 4.950 3.465 N TSNARE1 n/a
5 TRCN0000142437 GCTGATGATGAGAAGGTCTTT pLKO.1 1201 3UTR 100% 4.950 3.465 N TSNARE1 n/a
6 TRCN0000144891 GAATCAGATCATCAAGGACTT pLKO.1 1350 3UTR 100% 4.050 2.835 N TSNARE1 n/a
7 TRCN0000139660 GAAGGTCTTTAACGGGAGTGA pLKO.1 1212 3UTR 100% 2.640 1.848 N TSNARE1 n/a
8 TRCN0000140488 GAGAAGGTCTTTAACGGGAGT pLKO.1 1210 3UTR 100% 2.160 1.512 N TSNARE1 n/a
9 TRCN0000140016 GAGCAAGGAGAAGCTGTTGAT pLKO.1 1387 3UTR 100% 4.950 3.465 N TSNARE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_928308.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13397 pDONR223 100% 58.7% None (many diffs) n/a
2 TRCN0000480078 GAGCTTGGTGTTCGTCCACGAAGA pLX_317 24% 58.7% V5 (many diffs) n/a
3 ccsbBroadEn_05205 pDONR223 100% 58.6% None (many diffs) n/a
4 ccsbBroad304_05205 pLX_304 0% 58.6% V5 (many diffs) n/a
5 TRCN0000465424 AGAGGACCTCTTTCGGCACCTCGG pLX_317 25.7% 58.6% V5 (many diffs) n/a
Download CSV