Transcript: Human XR_940363.2

PREDICTED: Homo sapiens autophagy related 7 (ATG7), transcript variant X15, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATG7 (10533)
Length:
2935
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_940363.2
NBCI Gene record:
ATG7 (10533)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_940363.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000369085 TCCAAAGTTCTTGATCAATAT pLKO_005 2399 3UTR 100% 13.200 10.560 N ATG7 n/a
2 TRCN0000364480 CAAGGACATTAAGGGTTATTA pLKO_005 580 3UTR 100% 15.000 10.500 N ATG7 n/a
3 TRCN0000435480 CACCAGTTCAGAGCTAAATAA pLKO_005 2881 3UTR 100% 15.000 10.500 N ATG7 n/a
4 TRCN0000007586 GCTTTGGGATTTGACACATTT pLKO.1 1943 3UTR 100% 13.200 9.240 N ATG7 n/a
5 TRCN0000377305 GGCGTGAGACACATCACATTT pLKO_005 1580 3UTR 100% 13.200 9.240 N ATG7 n/a
6 TRCN0000364479 TGAGTCATCAGTGGATCTAAA pLKO_005 1435 3UTR 100% 13.200 9.240 N ATG7 n/a
7 TRCN0000007587 CCCAGCTATTGGAACACTGTA pLKO.1 691 3UTR 100% 4.950 3.465 N ATG7 n/a
8 TRCN0000007585 CCAGAGAGTTTACCTCTCATT pLKO.1 914 3UTR 100% 0.495 0.347 N ATG7 n/a
9 TRCN0000007584 GCCTGCTGAGGAGCTCTCCAT pLKO.1 2731 3UTR 100% 0.000 0.000 N ATG7 n/a
10 TRCN0000364478 CTTGACATTTGCAGATCTAAA pLKO_005 847 3UTR 100% 13.200 7.920 N ATG7 n/a
11 TRCN0000007588 CCAAGGTCAAAGGACGAAGAT pLKO.1 1108 3UTR 100% 4.950 2.970 N ATG7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_940363.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02460 pDONR223 100% 69% None (many diffs) n/a
2 ccsbBroad304_02460 pLX_304 0% 69% V5 (many diffs) n/a
3 TRCN0000472530 ACCACTTTTGACACCTGTACTAAC pLX_317 21.4% 69% V5 (many diffs) n/a
Download CSV