Construct: ORF TRCN0000466536
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002331.1_s317c1
- Derived from:
- ccsbBroadEn_15630
- DNA Barcode:
- CGATTGTCATTCGGCCGACTATTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- H2AC18 (8337)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466536
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 723790 | H2AC19 | H2A clustered histone 19 | NM_001040874.1 | 100% | 100% | |
2 | human | 8337 | H2AC18 | H2A clustered histone 18 | NM_003516.2 | 100% | 100% | |
3 | human | 8338 | H2AC20 | H2A clustered histone 20 | NM_003517.2 | 94.3% | 98.4% | (many diffs) |
4 | human | 8329 | H2AC13 | H2A clustered histone 13 | NM_003509.2 | 87.4% | 98.4% | (many diffs) |
5 | human | 92815 | H2AW | H2A.W histone | NM_033445.2 | 86.6% | 97.6% | (many diffs) |
6 | human | 8969 | H2AC11 | H2A clustered histone 11 | NM_021064.4 | 86.4% | 98.4% | (many diffs) |
7 | human | 8334 | H2AC6 | H2A clustered histone 6 | NM_003512.3 | 86.1% | 98.4% | (many diffs) |
8 | human | 8336 | H2AC17 | H2A clustered histone 17 | NM_003514.2 | 85.6% | 98.4% | (many diffs) |
9 | human | 8331 | H2AC14 | H2A clustered histone 14 | NM_021066.2 | 85.3% | 96.1% | (many diffs) |
10 | human | 317772 | H2AC21 | H2A clustered histone 21 | NM_175065.2 | 85.1% | 94.6% | (many diffs) |
11 | human | 3013 | H2AC7 | H2A clustered histone 7 | NM_021065.3 | 85.1% | 97.6% | (many diffs) |
12 | human | 85235 | H2AC12 | H2A clustered histone 12 | NM_080596.2 | 84.6% | 96.9% | (many diffs) |
13 | human | 8332 | H2AC16 | H2A clustered histone 16 | NM_003511.2 | 84.3% | 98.4% | (many diffs) |
14 | human | 8330 | H2AC15 | H2A clustered histone 15 | NM_003510.2 | 83.8% | 98.4% | (many diffs) |
15 | human | 55766 | H2AJ | H2A.J histone | NM_177925.3 | 82.8% | 95.3% | (many diffs) |
16 | human | 3012 | H2AC8 | H2A clustered histone 8 | NM_021052.2 | 82.3% | 96.9% | (many diffs) |
17 | human | 8335 | H2AC4 | H2A clustered histone 4 | NM_003513.2 | 81% | 96.9% | (many diffs) |
18 | human | 3014 | H2AX | H2A.X variant histone | NM_002105.2 | 75.8% | 83.9% | (many diffs) |
19 | mouse | 15267 | Hist2h2aa1 | histone cluster 2, H2aa1 | NM_013549.2 | 89.4% | 100% | (many diffs) |
20 | mouse | 319192 | Hist2h2aa2 | histone cluster 2, H2aa2 | NM_178212.3 | 89.4% | 100% | (many diffs) |
21 | mouse | 319176 | Hist2h2ac | histone cluster 2, H2ac | NM_175662.2 | 87.9% | 98.4% | (many diffs) |
22 | mouse | 319172 | Hist1h2ab | histone cluster 1, H2ab | NM_175660.3 | 86.4% | 96.9% | (many diffs) |
23 | mouse | 665433 | Hist1h2ao | histone cluster 1, H2ao | NM_001177544.2 | 86.1% | 96.9% | (many diffs) |
24 | mouse | 319191 | Hist1h2ai | histone cluster 1, H2ai | NM_178182.2 | 86.1% | 96.9% | (many diffs) |
25 | mouse | 319171 | Hist1h2ap | histone cluster 1, H2ap | NM_178185.2 | 86.1% | 96.9% | (many diffs) |
26 | mouse | 319170 | Hist1h2an | histone cluster 1, H2an | NM_178184.2 | 85.8% | 96.9% | (many diffs) |
27 | mouse | 319167 | Hist1h2ag | histone cluster 1, H2ag | NM_178186.3 | 85.8% | 96.9% | (many diffs) |
28 | mouse | 319166 | Hist1h2ae | histone cluster 1, H2ae | NM_178187.4 | 85.8% | 96.9% | (many diffs) |
29 | mouse | 319164 | Hist1h2ac | histone cluster 1, H2ac | NM_178189.5 | 85.8% | 96.9% | (many diffs) |
30 | mouse | 232440 | H2afj | H2A histone family, member J | NM_177688.4 | 85.8% | 94.6% | (many diffs) |
31 | mouse | 319165 | Hist1h2ad | histone cluster 1, H2ad | NM_178188.4 | 85.6% | 96.9% | (many diffs) |
32 | mouse | 319169 | Hist1h2ak | histone cluster 1, H2ak | NM_178183.2 | 85.3% | 96.1% | (many diffs) |
33 | mouse | 319173 | Hist1h2af | histone cluster 1, H2af | NM_175661.2 | 85.1% | 96.1% | (many diffs) |
34 | mouse | 319168 | Hist1h2ah | histone cluster 1, H2ah | NM_175659.2 | 84.6% | 95.3% | (many diffs) |
35 | mouse | 621893 | Hist2h2ab | histone cluster 2, H2ab | NM_178213.4 | 82.1% | 95.3% | (many diffs) |
36 | mouse | 319162 | Hist3h2a | histone cluster 3, H2a | NM_178218.4 | 81% | 97.6% | (many diffs) |
37 | mouse | 15270 | H2afx | H2A histone family, member X | NM_010436.2 | 77.6% | 83.2% | (many diffs) |
38 | mouse | 667728 | Hist1h2al | histone cluster 1, H2al | NR_132443.1 | 11.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 456
- ORF length:
- 390
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc tggtcgtggc aagcaaggag gcaaggcccg cgccaaggcc aagtcgcgct 121 cgtcccgcgc tggccttcag ttcccggtag ggcgagtgca tcgcttgctg cgcaaaggca 181 actacgcgga gcgagtgggg gccggcgcgc ccgtctacat ggctgcggtc ctcgagtatc 241 tgaccgccga gatCCTGGAG CTGGCGGGCA ACGCGGCTCG GGACAACAAG AAGACGCGCA 301 TCATCCCTCG TCACCTCCAG CTGGCCATCC GCAACGACGA GGAACTGAAC AAGCTGCTGG 361 GCAAAGTCAC CATCGCCCAG GGCGGCGTCT TGCCTAACAT CCAGGCCGTA CTGCTCCCTA 421 AGAAGACGGA GAGTCACCAC AAGGCAAAGG GCAAGTGCCC AACTTTCTTG TACAAAGTGG 481 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 541 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 601 ACGATTGTCA TTCGGCCGAC TATTCACGCG TTAAGTCgac aatcaacctc tggattacaa 661 aatttgtgaa agatt