Transcript: Mouse NM_178185.2

Mus musculus histone cluster 1, H2ap (Hist1h2ap), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Hist1h2ap (319171)
Length:
452
CDS:
1..393

Additional Resources:

NCBI RefSeq record:
NM_178185.2
NBCI Gene record:
Hist1h2ap (319171)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178185.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074588 CAACAAGAAGACGCGCATCAT pLKO.1 219 CDS 100% 4.950 2.475 Y H2AC18 n/a
2 TRCN0000242129 CAACAAGAAGACGCGCATCAT pLKO_005 219 CDS 100% 4.950 2.475 Y Hist1h2ad n/a
3 TRCN0000242133 CAACGACGAGGAGCTCAACAA pLKO_005 267 CDS 100% 4.950 2.475 Y Hist1h2ag n/a
4 TRCN0000364413 CAACGACGAGGAGCTCAACAA pLKO_005 267 CDS 100% 4.950 2.475 Y H2AX n/a
5 TRCN0000097001 ACAACAAGAAGACGCGCATCA pLKO.1 218 CDS 100% 4.050 2.025 Y Hist2h2ac n/a
6 TRCN0000256521 ACAACAAGAAGACGCGCATCA pLKO_005 218 CDS 100% 4.050 2.025 Y H2AC19 n/a
7 TRCN0000257783 ACAAGAAGACGCGCATCATCC pLKO_005 221 CDS 100% 4.050 2.025 Y Hist1h2an n/a
8 TRCN0000429705 ACAAGAAGACGCGCATCATCC pLKO_005 221 CDS 100% 4.050 2.025 Y H2AC20 n/a
9 TRCN0000257997 GACAACAAGAAGACGCGCATC pLKO_005 217 CDS 100% 2.250 1.125 Y Hist1h2af n/a
10 TRCN0000092689 CGACAACAAGAAGACGCGCAT pLKO.1 216 CDS 100% 2.160 1.080 Y Hist2h2aa2 n/a
11 TRCN0000429526 CGACAACAAGAAGACGCGCAT pLKO_005 216 CDS 100% 2.160 1.080 Y H2AW n/a
12 TRCN0000369835 GCAACGACGAGGAGCTCAACA pLKO_005 266 CDS 100% 1.650 0.825 Y H2AC17 n/a
13 TRCN0000097017 TGCTCCGCAAGGGCAACTACT pLKO.1 101 CDS 100% 1.650 0.825 Y Hist1h2ap n/a
14 TRCN0000097020 GAAGACCGAGAGCCACCACAA pLKO.1 357 CDS 100% 1.350 0.675 Y Hist1h2ae n/a
15 TRCN0000433810 CGACGAGGAGCTCAACAAGCT pLKO_005 270 CDS 100% 0.880 0.440 Y H2AW n/a
16 TRCN0000255257 CAAGAAGACGCGCATCATCCC pLKO_005 222 CDS 100% 0.720 0.360 Y Hist2h2ab n/a
17 TRCN0000097023 CGAGGAGCTCAACAAGCTGCT pLKO.1 273 CDS 100% 0.720 0.360 Y Hist1h2ae n/a
18 TRCN0000092692 GCGACAACAAGAAGACGCGCA pLKO.1 215 CDS 100% 0.180 0.090 Y Hist2h2aa2 n/a
19 TRCN0000258002 ACCTGACGGCCGAGATCCTGG pLKO_005 173 CDS 100% 0.000 0.000 Y Hist1h2af n/a
20 TRCN0000256452 ACGGCCGAGATCCTGGAGCTG pLKO_005 178 CDS 100% 0.000 0.000 Y Hist1h2ai n/a
21 TRCN0000256979 AGGCTCGCGCCAAGGCCAAGA pLKO_005 29 CDS 100% 0.000 0.000 Y Hist1h2ad n/a
22 TRCN0000242134 CAACATCCAGGCCGTGCTGCT pLKO_005 330 CDS 100% 0.000 0.000 Y Hist1h2ag n/a
23 TRCN0000257802 CAAGGCCAAGACCCGCTCCTC pLKO_005 39 CDS 100% 0.000 0.000 Y Hist1h2an n/a
24 TRCN0000255948 CAAGGCTCGCGCCAAGGCCAA pLKO_005 27 CDS 100% 0.000 0.000 Y Hist1h2ah n/a
25 TRCN0000097015 CCAAGGCCAAGACCCGCTCCT pLKO.1 38 CDS 100% 0.000 0.000 Y Hist1h2ap n/a
26 TRCN0000255946 CCCGCGACAACAAGAAGACGC pLKO_005 212 CDS 100% 0.000 0.000 Y Hist1h2ah n/a
27 TRCN0000097030 CCGCAACGACGAGGAGCTCAA pLKO.1 264 CDS 100% 0.000 0.000 Y Hist1h2ab n/a
28 TRCN0000097018 CCGCAAGGGCAACTACTCGGA pLKO.1 105 CDS 100% 0.000 0.000 Y Hist1h2ap n/a
29 TRCN0000255950 CCTGACGGCCGAGATCCTGGA pLKO_005 174 CDS 100% 0.000 0.000 Y Hist1h2ah n/a
30 TRCN0000097032 CCTGCAGCTGGCCATCCGCAA pLKO.1 249 CDS 100% 0.000 0.000 Y Hist1h2ab n/a
31 TRCN0000073282 CCTGCCCAACATCCAGGCCGT pLKO.1 324 CDS 100% 0.000 0.000 Y H2AX n/a
32 TRCN0000097028 CGAGAGCCACCACAAGGCCAA pLKO.1 363 CDS 100% 0.000 0.000 Y Hist1h2ac n/a
33 TRCN0000257770 CGGCCGTGCTGGAGTACCTGA pLKO_005 158 CDS 100% 0.000 0.000 Y Hist1h2an n/a
34 TRCN0000250198 CTCCGCAAGGGCAACTACTCG pLKO_005 103 CDS 100% 0.000 0.000 Y Hist1h2af n/a
35 TRCN0000257792 CTGCTCCGCAAGGGCAACTAC pLKO_005 100 CDS 100% 0.000 0.000 Y Hist1h2an n/a
36 TRCN0000369944 CTGCTCCGCAAGGGCAACTAC pLKO_005 100 CDS 100% 0.000 0.000 Y H2AC17 n/a
37 TRCN0000242130 GCAACTACTCGGAGCGCGTGG pLKO_005 113 CDS 100% 0.000 0.000 Y Hist1h2ad n/a
38 TRCN0000242131 GCAGCTGGCCATCCGCAACGA pLKO_005 252 CDS 100% 0.000 0.000 Y Hist1h2ag n/a
39 TRCN0000097022 GCCCAAGAAGACCGAGAGCCA pLKO.1 351 CDS 100% 0.000 0.000 Y Hist1h2ae n/a
40 TRCN0000255949 GCCGTGCTGGAGTACCTGACG pLKO_005 160 CDS 100% 0.000 0.000 Y Hist1h2ah n/a
41 TRCN0000256987 GCTCCGCAAGGGCAACTACTC pLKO_005 102 CDS 100% 0.000 0.000 Y Hist1h2ad n/a
42 TRCN0000097014 GCTGCTCCGCAAGGGCAACTA pLKO.1 99 CDS 100% 0.000 0.000 Y Hist1h2ap n/a
43 TRCN0000097016 GCTGGAGTACCTGACGGCCGA pLKO.1 165 CDS 100% 0.000 0.000 Y Hist1h2ap n/a
44 TRCN0000097031 GCTGGCCATCCGCAACGACGA pLKO.1 255 CDS 100% 0.000 0.000 Y Hist1h2ab n/a
45 TRCN0000242128 GGAGTACCTGACGGCCGAGAT pLKO_005 168 CDS 100% 0.000 0.000 Y Hist1h2ad n/a
46 TRCN0000242136 GGCAACTACTCGGAGCGCGTG pLKO_005 112 CDS 100% 0.000 0.000 Y Hist1h2ak n/a
47 TRCN0000250199 GGCCGTGCTGGAGTACCTGAC pLKO_005 159 CDS 100% 0.000 0.000 Y Hist1h2af n/a
48 TRCN0000265807 GGCTGCTCCGCAAGGGCAACT pLKO_005 98 CDS 100% 0.000 0.000 Y Hist1h2ai n/a
49 TRCN0000256453 GGGCAACTACTCGGAGCGCGT pLKO_005 111 CDS 100% 0.000 0.000 Y Hist1h2ai n/a
50 TRCN0000257780 TACCTGACGGCCGAGATCCTG pLKO_005 172 CDS 100% 0.000 0.000 Y Hist1h2an n/a
51 TRCN0000255947 TCCGCAAGGGCAACTACTCGG pLKO_005 104 CDS 100% 0.000 0.000 Y Hist1h2ah n/a
52 TRCN0000256451 TGGAGTACCTGACGGCCGAGA pLKO_005 167 CDS 100% 0.000 0.000 Y Hist1h2ai n/a
53 TRCN0000106912 TGCTCCGCAAGGGCAACTATT pLKO.1 101 CDS 100% 13.200 6.600 Y H2AW n/a
54 TRCN0000106732 CTGCTCCGCAAGGGCAACTAT pLKO.1 100 CDS 100% 1.875 0.938 Y H2AC16 n/a
55 TRCN0000368904 TGCTGCTGCCCAAGAAGACCA pLKO_005 344 CDS 100% 0.880 0.440 Y H2AX n/a
56 TRCN0000106659 CCAAGGCCAAGACCCGCTCTT pLKO.1 38 CDS 100% 0.000 0.000 Y H2AC14 n/a
57 TRCN0000256450 CTCGCGCCAAGGCCAAGACTC pLKO_005 32 CDS 100% 0.000 0.000 Y Hist1h2ai n/a
58 TRCN0000074592 GCCATCCGCAACGACGAGGAA pLKO.1 259 CDS 100% 0.000 0.000 Y H2AC18 n/a
59 TRCN0000106666 GCCGAGATCCTGGAGCTGGCT pLKO.1 181 CDS 100% 0.000 0.000 Y H2AC13 n/a
60 TRCN0000096998 GCTCAACAAGCTGCTGGGCAA pLKO.1 279 CDS 100% 0.720 0.360 Y Hist2h2aa1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178185.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04591 pDONR223 100% 92.5% 99.2% None (many diffs) n/a
2 ccsbBroad304_04591 pLX_304 0% 92.5% 99.2% V5 (many diffs) n/a
3 TRCN0000472223 CCTTGCTACGATGTATGAGACTTA pLX_317 100% 92.5% 99.2% V5 (many diffs) n/a
4 ccsbBroadEn_01893 pDONR223 100% 90.5% 98.4% None (many diffs) n/a
5 ccsbBroad304_01893 pLX_304 97.8% 90.5% 98.4% V5 (many diffs) n/a
6 TRCN0000469277 CTTGTACACGCATGGACCTTCTTT pLX_317 100% 90.5% 98.4% V5 (many diffs) n/a
7 ccsbBroadEn_01891 pDONR223 100% 89.4% 98.4% None (many diffs) n/a
8 ccsbBroad304_01891 pLX_304 0% 89.4% 98.4% V5 (many diffs) n/a
9 TRCN0000481190 CGTGTTGGCCGTTCGATTTAGAAT pLX_317 98.5% 89.4% 98.4% V5 (many diffs) n/a
10 ccsbBroadEn_02055 pDONR223 100% 88.4% 98.4% None (many diffs) n/a
11 ccsbBroad304_02055 pLX_304 0% 88.4% 98.4% V5 (many diffs) n/a
12 TRCN0000466333 TGGGGTTTAATTGCATTCTTGTTA pLX_317 72.6% 88.4% 98.4% V5 (many diffs) n/a
13 ccsbBroadEn_01892 pDONR223 100% 88.4% 98.4% None (many diffs) n/a
14 ccsbBroad304_01892 pLX_304 0% 88.4% 98.4% V5 (many diffs) n/a
15 TRCN0000473552 GACAAACTTCCATCCTCTTGAACC pLX_317 98.5% 88.4% 98.4% V5 (many diffs) n/a
16 ccsbBroadEn_01895 pDONR223 100% 87.9% 98.4% None (many diffs) n/a
17 ccsbBroad304_01895 pLX_304 0% 87.9% 98.4% V5 (many diffs) n/a
18 TRCN0000468567 AACCATAGCTAACCCTGCACACAC pLX_317 100% 87.9% 98.4% V5 (many diffs) n/a
19 ccsbBroadEn_01894 pDONR223 100% 87.6% 98.4% None (many diffs) n/a
20 ccsbBroad304_01894 pLX_304 0% 87.6% 98.4% V5 (many diffs) n/a
21 TRCN0000466135 ATCGATAACCATCGCTTACCTGGA pLX_317 72.6% 87.6% 98.4% V5 (many diffs) n/a
22 ccsbBroadEn_15628 pDONR223 0% 87.4% 96.1% None (many diffs) n/a
23 ccsbBroad304_15628 pLX_304 0% 87.4% 96.1% V5 (many diffs) n/a
24 TRCN0000474646 TCTACAGTCTCGTAGCTATGTTCA pLX_317 100% 87.4% 96.1% V5 (many diffs) n/a
25 ccsbBroadEn_07222 pDONR223 100% 87.4% 96.1% None (many diffs) n/a
26 ccsbBroad304_07222 pLX_304 0% 87.4% 96.1% V5 (many diffs) n/a
27 TRCN0000474296 CCGAGAACTTAGACACGTTCATCC pLX_317 98.5% 87.4% 96.1% V5 (many diffs) n/a
28 ccsbBroadEn_15629 pDONR223 0% 87.4% 98.4% None (many diffs) n/a
29 ccsbBroad304_15629 pLX_304 0% 87.4% 98.4% V5 (many diffs) n/a
30 TRCN0000469353 AGACAGTAAACCCGGGATGCGCAC pLX_317 73.4% 87.4% 98.4% V5 (many diffs) n/a
31 ccsbBroadEn_09253 pDONR223 100% 86.4% 96.9% None (many diffs) n/a
32 ccsbBroad304_09253 pLX_304 0% 86.4% 96.9% V5 (many diffs) n/a
33 TRCN0000479809 GGTCGAATGGTCGCATTAGATTCC pLX_317 80.6% 86.1% 96.9% V5 (many diffs) n/a
34 ccsbBroadEn_15631 pDONR223 0% 85.8% 96.9% None (many diffs) n/a
35 ccsbBroad304_15631 pLX_304 0% 85.8% 96.9% V5 (many diffs) n/a
36 ccsbBroadEn_15630 pDONR223 0% 86.1% 96.9% None (many diffs) n/a
37 ccsbBroad304_15630 pLX_304 0% 86.1% 96.9% V5 (many diffs) n/a
38 TRCN0000466536 CGATTGTCATTCGGCCGACTATTC pLX_317 51.9% 86.1% 96.9% V5 (many diffs) n/a
39 ccsbBroadEn_11266 pDONR223 100% 85.8% 96.9% None (many diffs) n/a
40 ccsbBroad304_11266 pLX_304 0% 85.8% 96.9% V5 (many diffs) n/a
41 TRCN0000473665 CTTGAACTGGACTCCCACCGCACC pLX_317 98.5% 85.8% 96.9% V5 (many diffs) n/a
42 ccsbBroadEn_03650 pDONR223 100% 85.3% 93.8% None (many diffs) n/a
43 ccsbBroad304_03650 pLX_304 0% 85.3% 93.8% V5 (many diffs) n/a
44 TRCN0000478286 ACAGCCCAAGTATGTTGCTGTGAT pLX_317 83.7% 85.3% 93.8% V5 (many diffs) n/a
45 ccsbBroadEn_01896 pDONR223 100% 85.1% 95.3% None (many diffs) n/a
46 ccsbBroad304_01896 pLX_304 0% 85.1% 95.3% V5 (many diffs) n/a
47 TRCN0000480994 TCCGAGTATGCGTATGATAAGCCC pLX_317 94.3% 85.1% 95.3% V5 (many diffs) n/a
48 ccsbBroadEn_00717 pDONR223 100% 81.1% 83.2% None (many diffs) n/a
49 ccsbBroad304_00717 pLX_304 0% 81.1% 83.2% V5 (many diffs) n/a
50 TRCN0000469289 TCCAAGCCCTCATTGGAGCTGGTC pLX_317 100% 81.1% 83.2% V5 (many diffs) n/a
Download CSV

GPP Web Portal Terms of Service

Effective Date: December 8, 2025
By using this site, you agree to our terms and conditions below.

Overview of Terms

The data made available on this website were generated for research purposes and are not intended for clinical or commercial uses. Commercial use (or other use for profit-making purposes) of the GPP Web Portal and its tools, is not permitted under these terms and may require a separate license agreement from Broad or its contributors. For more information, please contact partnering@broadinstitute.org.

The original data may be subject to rights claimed by third parties, including but not limited to, patent, copyright, other intellectual property rights, biodiversity-related access and benefit-sharing rights. It is the responsibility of users of Broad Institute services to ensure that their use of the data does not infringe any of the rights of such third parties.

Any questions or comments concerning these Terms of Use can be addressed to: legal@broadinstitute.org.

By accessing and viewing this GPP Web Portal, you agree to the following terms and conditions:

Attribution

You agree to acknowledge the Broad Institute (e.g., in publications, services or products) for any of your use of its online services, databases or software in accordance with good scientific practice. You agree to use the acknowledgment wording provided for the relevant tools as indicated on the FAQ for each tool.

Updating the Terms of Use

We reserve the right to update these Terms of Use at any time. When alterations are inevitable, we will attempt to give reasonable notice of any changes by placing a notice on our website, but you may wish to check each time you use the website. The date of the most recent revision will appear on this, the "GPP Web Portal Terms of Use" page. If you do not agree to these changes, please do not continue to use our online services. We will also make available an archived copy of the previous Terms of Use for comparison.

Indemnification and Disclaimer of Warranties

You are using this GPP Web Portal at your own risk, and you hereby agree to hold Broad and its contributors and their trustees, directors, officers, employees, and affiliated investigators harmless for any third party claims which may arise from your use of the GPP Web Portal, the tools available therein, or any portion thereof. Further, you agree to indemnify Broad, its contributors, and its and their trustees, directors, officers, employees, affiliated investigators, students, and affiliates for any loss, costs, claims, damages, or other liabilities arising from any unpermitted commercial or profit-making use you make of the GPP Web Portal. The GPP Web Portal is a research tool and is provided "as is". Broad does not represent that the GPP Web Portal is free of errors or bugs or suitable for any particular tasks.

ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS ARE DISCLAIMED. IN NO EVENT SHALL BROAD OR ITS CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THE GPP WEB PORTAL, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.

Governing Law

The terms and conditions herein shall be construed, governed, interpreted, and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A. Furthermore, by accessing, downloading, or using the Database, You consent to the personal jurisdiction of, and venue in, the state and federal courts within Massachusetts with respect to Your download or use of the Database.