Construct: ORF TRCN0000473511
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002072.4_s317c1
- Derived from:
- ccsbBroadEn_06278
- DNA Barcode:
- TCCACTTGCGAAGTCGGGCGCCAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GK (2710)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473511
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 2710 | GK | glycerol kinase | NM_203391.3 | 99.8% | 99.6% | 237T>A;391C>A;501C>A |
2 | human | 2710 | GK | glycerol kinase | NM_000167.5 | 98.6% | 98.4% | (many diffs) |
3 | human | 2710 | GK | glycerol kinase | XM_011545492.1 | 94.8% | 94.6% | (many diffs) |
4 | human | 2710 | GK | glycerol kinase | NM_001205019.1 | 94.3% | 94.2% | (many diffs) |
5 | human | 2710 | GK | glycerol kinase | XM_006724484.2 | 93.7% | 93.5% | (many diffs) |
6 | human | 2710 | GK | glycerol kinase | NM_001128127.2 | 93.3% | 93.2% | (many diffs) |
7 | human | 2710 | GK | glycerol kinase | XM_011545491.2 | 89.8% | 89.7% | (many diffs) |
8 | human | 2710 | GK | glycerol kinase | XM_006724483.2 | 88.8% | 88.7% | (many diffs) |
9 | human | 2712 | GK2 | glycerol kinase 2 | NM_033214.3 | 82.5% | 82.1% | (many diffs) |
10 | human | 2713 | GK3P | glycerol kinase 3 pseudogene | NR_026575.1 | 68.1% | (many diffs) | |
11 | human | 2710 | GK | glycerol kinase | XM_017029410.1 | 61.3% | 61.3% | 0_1ins615 |
12 | human | 2710 | GK | glycerol kinase | XM_017029411.1 | 60.1% | 60.1% | 0_1ins615;112_113insTGAAAATCTCTCATAGCG |
13 | human | 2710 | GK | glycerol kinase | XM_017029412.2 | 60.1% | 60.1% | 0_1ins615;112_113insTGAAAATCTCTCATAGCG |
14 | human | 2710 | GK | glycerol kinase | XM_006724485.2 | 57.9% | 57.9% | 0_1ins615;970_972delGACinsATT;975_1062delinsA |
15 | human | 2710 | GK | glycerol kinase | XM_006724486.3 | 57.9% | 57.9% | 0_1ins615;970_972delGACinsATT;975_1062delinsA |
16 | human | 2710 | GK | glycerol kinase | XM_011545493.2 | 57.9% | 57.9% | 0_1ins615;970_972delGACinsATT;975_1062delinsA |
17 | human | 2710 | GK | glycerol kinase | XM_011545494.2 | 57.9% | 57.9% | 0_1ins615;970_972delGACinsATT;975_1062delinsA |
18 | human | 2710 | GK | glycerol kinase | XM_017029409.1 | 57.9% | 57.9% | 0_1ins615;970_972delGACinsATT;975_1062delinsA |
19 | human | 2710 | GK | glycerol kinase | XM_005274488.4 | 56.8% | 56.8% | (many diffs) |
20 | mouse | 14933 | Gk | glycerol kinase | NM_001331046.1 | 91.4% | 96.7% | (many diffs) |
21 | mouse | 14933 | Gk | glycerol kinase | NM_008194.3 | 90.3% | 95.8% | (many diffs) |
22 | mouse | 14933 | Gk | glycerol kinase | XM_006527833.3 | 86.8% | 91.9% | (many diffs) |
23 | mouse | 14933 | Gk | glycerol kinase | NM_001294140.1 | 86.5% | 91.5% | (many diffs) |
24 | mouse | 14933 | Gk | glycerol kinase | NM_001294138.1 | 85.8% | 91% | (many diffs) |
25 | mouse | 14933 | Gk | glycerol kinase | NM_212444.2 | 85.5% | 90.6% | (many diffs) |
26 | mouse | 14933 | Gk | glycerol kinase | XM_006527829.3 | 82.3% | 87.2% | (many diffs) |
27 | mouse | 14933 | Gk | glycerol kinase | XM_006527831.3 | 81.4% | 86.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1656
- ORF length:
- 1590
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc agcctcaaag aaggcagttt tggggccatt ggtgggggcg gtggaccagg 121 gcaccagttc gacgcgcttt ttggttttca attcaaaaac agctgaacta cttagtcatc 181 atcaagtaga aataaaacaa gagttcccaa gagaaggatg ggtggaacag gaccctaagg 241 aaattctaca ttctgtctat gagtgtatag agaaaacatg tgagaaactt ggacagctca 301 aaattgatat ttccaacata aaagctattg gtgtcagcaa ccagagggaa accactgtag 361 tctgggacaa gataactgga gagcctctct acaatgctgt ggtgtggctt gatctaagaa 421 cccagtctac cgttgagagt cttagtaaaa gaattacagg aaataataac tttgtcaagt 481 ccaagacagg ccttccactt agcacttact tcagtgcagt gaaacttcgt tggctccttg 541 acaatgtgag aaaagttcaa aaggcagttg aagaaaaacg agctcttttt gggactattg 601 attcatggct tatttggagt ttgacaggag gagtcaatgg aggtgtccac tgtacagatg 661 taacaaatgc aagtaggact atgcttttca acattcattc tttggaatgg gataaacaac 721 tctgcgaatt ttttggaatt ccaatggaaa ttcttccaaa tgtccggagt tcttctgaga 781 tctatggcct aatgaaaatc tctcatagcg tgaaagctgg ggccttggaa ggtgtgccaa 841 tatctgggtg tttaggggac cagtctgctg cattggtggg acaaatgtgc ttccagattg 901 gacaagccaa aaatacgtat ggaacaggat gtttcttact atgtaataca ggccataagt 961 gtgtattttc tgatcatggc cttctcacca cagtggctta caaacttggc agagacaaac 1021 cagtatatta tgctttggaa ggttctgtag ctatagctgg tgctgttatt cgctggctaa 1081 gagacaatct tggaattata aagacctcag aagaaattga aaaacttgct aaagaagtag 1141 gtacttctta tGGCTGCTAC TTCGTCCCAG CATTTTCGGG GTTATATGCA CCTTATTGGG 1201 AGCCCAGCGC AAGAGGGATA ATCTGTGGAC TCACTCAGTT CACCAATAAA TGCCATATTG 1261 CTTTTGCTGC ATTAGAAGCT GTTTGTTTCC AAACTCGAGA GATTTTGGAT GCCATGAATC 1321 GAGACTGTGG AATTCCACTC AGTCATTTGC AGGTAGATGG AGGAATGACC AGCAACAAAA 1381 TTCTTATGCA GCTACAAGCA GACATTCTGT ATATACCAGT AGTGAAGCCC TCAATGCCCG 1441 AAACCACTGC ACTGGGTGCG GCTATGGCGG CAGGGGCTGC AGAAGGAGTC GGCGTATGGA 1501 GTCTCGAACC CGAGGATTTG TCTGCCGTCA CGATGGAGCG GTTTGAACCT CAGATTAATG 1561 CGGAGGAAAG TGAAATTCGT TATTCTACAT GGAAGAAAGC TGTGATGAAG TCAATGGGTT 1621 GGGTTACAAC TCAATCTCCA GAAAGTGGTA TTCCATACCC AACTTTCTTG TACAAAGTGG 1681 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1741 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1801 ATCCACTTGC GAAGTCGGGC GCCAGACGCG TTAAGTCgac aatcaacctc tggattacaa 1861 aatttgtgaa agatt