Transcript: Human NR_026575.1

Homo sapiens glycerol kinase 3 pseudogene (GK3P), non-coding RNA.

Source:
NCBI, updated 2018-05-25
Taxon:
Homo sapiens (human)
Gene:
GK3P (2713)
Length:
2232
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_026575.1
NBCI Gene record:
GK3P (2713)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_026575.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196785 GACTATTGATTCATGGCTTAT pLKO.1 906 3UTR 100% 10.800 5.400 Y GK n/a
2 TRCN0000037638 CTCACCACAGTGGCTTACAAA pLKO.1 1279 3UTR 100% 5.625 2.813 Y GK n/a
3 TRCN0000037637 ACATTCTGTCTATGAGTGTAT pLKO.1 561 3UTR 100% 4.950 2.475 Y GK n/a
4 TRCN0000291065 ACATTCTGTCTATGAGTGTAT pLKO_005 561 3UTR 100% 4.950 2.475 Y GK n/a
5 TRCN0000196762 GCTGAACTACTTAGTCATCAT pLKO.1 475 3UTR 100% 4.950 2.475 Y GK n/a
6 TRCN0000037636 CTAAAGAAGTAGGTACTTCTT pLKO.1 1424 3UTR 100% 0.495 0.248 Y GK n/a
7 TRCN0000195234 CTGAGATCTATGGCCTAATTA pLKO.1 1088 3UTR 100% 15.000 7.500 Y GK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_026575.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10490 pDONR223 100% 74.2% None 1_378del;1831G>A;2038_2232del n/a
2 ccsbBroad304_10490 pLX_304 0% 74.2% V5 1_378del;1831G>A;2038_2232del n/a
3 TRCN0000479938 GTACCAGTTGGTCTCCCACTAACC pLX_317 24.1% 74.2% V5 1_378del;1831G>A;2038_2232del n/a
4 ccsbBroadEn_06278 pDONR223 100% 68.1% None (many diffs) n/a
5 ccsbBroad304_06278 pLX_304 0% 68.1% V5 (many diffs) n/a
6 TRCN0000473511 TCCACTTGCGAAGTCGGGCGCCAG pLX_317 31.9% 68.1% V5 (many diffs) n/a
7 ccsbBroadEn_14655 pDONR223 0% 68.1% None (many diffs) n/a
8 ccsbBroad304_14655 pLX_304 0% 68.1% V5 (many diffs) n/a
9 TRCN0000470124 CTTTTCCAGCCGTATGCAGTACTA pLX_317 25.7% 68.1% V5 (many diffs) n/a
10 ccsbBroadEn_06279 pDONR223 100% 64.9% None (many diffs) n/a
11 ccsbBroad304_06279 pLX_304 0% 64.9% V5 (many diffs) n/a
12 ccsbBroadEn_14656 pDONR223 0% 64.9% None (many diffs) n/a
13 ccsbBroad304_14656 pLX_304 0% 64.9% V5 (many diffs) n/a
14 TRCN0000474895 TTTCTTGTATCACAAGGATTACCA pLX_317 31.2% 64.9% V5 (many diffs) n/a
Download CSV