Transcript: Human NM_001205019.1

Homo sapiens glycerol kinase (GK), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
GK (2710)
Length:
4590
CDS:
180..1859

Additional Resources:

NCBI RefSeq record:
NM_001205019.1
NBCI Gene record:
GK (2710)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001205019.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196319 GTAGGTTGAGTTCATTGTAAA pLKO.1 3565 3UTR 100% 13.200 18.480 N GK n/a
2 TRCN0000196700 GCAACGGTTATGCATAATATT pLKO.1 2728 3UTR 100% 15.000 10.500 N GK n/a
3 TRCN0000296846 GCAACGGTTATGCATAATATT pLKO_005 2728 3UTR 100% 15.000 10.500 N GK n/a
4 TRCN0000195024 CCAGCAATTCTGTCTCTTAAT pLKO.1 1914 3UTR 100% 13.200 9.240 N GK n/a
5 TRCN0000296850 CCAGCAATTCTGTCTCTTAAT pLKO_005 1914 3UTR 100% 13.200 9.240 N GK n/a
6 TRCN0000037635 ACCAGTAGTGAAGCCCTCAAT pLKO.1 1529 CDS 100% 4.950 3.465 N GK n/a
7 TRCN0000196599 GATAAACAACTCTGCGAATTT pLKO.1 825 CDS 100% 13.200 7.920 N GK n/a
8 TRCN0000296845 GATAAACAACTCTGCGAATTT pLKO_005 825 CDS 100% 13.200 7.920 N GK n/a
9 TRCN0000195040 CTTAATGCAATGACACTATTC pLKO.1 1929 3UTR 100% 10.800 6.480 N GK n/a
10 TRCN0000037634 CCGGAGTTCTTCTGAGATCTA pLKO.1 878 CDS 100% 4.950 2.970 N GK n/a
11 TRCN0000195270 CTTAGTCATCATCAAGTAGAA pLKO.1 285 CDS 100% 4.950 2.970 N GK n/a
12 TRCN0000196785 GACTATTGATTCATGGCTTAT pLKO.1 707 CDS 100% 10.800 5.400 Y GK n/a
13 TRCN0000037638 CTCACCACAGTGGCTTACAAA pLKO.1 1098 CDS 100% 5.625 2.813 Y GK n/a
14 TRCN0000037637 ACATTCTGTCTATGAGTGTAT pLKO.1 362 CDS 100% 4.950 2.475 Y GK n/a
15 TRCN0000291065 ACATTCTGTCTATGAGTGTAT pLKO_005 362 CDS 100% 4.950 2.475 Y GK n/a
16 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3808 3UTR 100% 4.950 2.475 Y ERAP2 n/a
17 TRCN0000196762 GCTGAACTACTTAGTCATCAT pLKO.1 276 CDS 100% 4.950 2.475 Y GK n/a
18 TRCN0000037636 CTAAAGAAGTAGGTACTTCTT pLKO.1 1243 CDS 100% 0.495 0.248 Y GK n/a
19 TRCN0000195234 CTGAGATCTATGGCCTAATTA pLKO.1 889 CDS 100% 15.000 7.500 Y GK2 n/a
20 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3809 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001205019.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10490 pDONR223 100% 96.8% 97.3% None (many diffs) n/a
2 ccsbBroad304_10490 pLX_304 0% 96.8% 97.3% V5 (many diffs) n/a
3 TRCN0000479938 GTACCAGTTGGTCTCCCACTAACC pLX_317 24.1% 96.8% 97.3% V5 (many diffs) n/a
4 ccsbBroadEn_06278 pDONR223 100% 94.3% 94.2% None (many diffs) n/a
5 ccsbBroad304_06278 pLX_304 0% 94.3% 94.2% V5 (many diffs) n/a
6 TRCN0000473511 TCCACTTGCGAAGTCGGGCGCCAG pLX_317 31.9% 94.3% 94.2% V5 (many diffs) n/a
7 ccsbBroadEn_14655 pDONR223 0% 94.3% 94.2% None (many diffs) n/a
8 ccsbBroad304_14655 pLX_304 0% 94.3% 94.2% V5 (many diffs) n/a
9 TRCN0000470124 CTTTTCCAGCCGTATGCAGTACTA pLX_317 25.7% 94.3% 94.2% V5 (many diffs) n/a
10 ccsbBroadEn_06279 pDONR223 100% 87.2% 87.4% None (many diffs) n/a
11 ccsbBroad304_06279 pLX_304 0% 87.2% 87.4% V5 (many diffs) n/a
12 ccsbBroadEn_14656 pDONR223 0% 87.2% 87.4% None (many diffs) n/a
13 ccsbBroad304_14656 pLX_304 0% 87.2% 87.4% V5 (many diffs) n/a
14 TRCN0000474895 TTTCTTGTATCACAAGGATTACCA pLX_317 31.2% 87.2% 87.4% V5 (many diffs) n/a
Download CSV