Transcript: Mouse NM_001331046.1

Mus musculus glycerol kinase (Gk), transcript variant 5, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Gk (14933)
Length:
4375
CDS:
317..1909

Additional Resources:

NCBI RefSeq record:
NM_001331046.1
NBCI Gene record:
Gk (14933)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001331046.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024654 CCTGTGTATTATGCGTTGGAA pLKO.1 1271 CDS 100% 3.000 2.400 N Gk n/a
2 TRCN0000319734 CCTGTGTATTATGCGTTGGAA pLKO_005 1271 CDS 100% 3.000 2.400 N Gk n/a
3 TRCN0000024656 CCATTGATTCATGGCTTATTT pLKO.1 846 CDS 100% 15.000 10.500 N Gk n/a
4 TRCN0000319760 CCATTGATTCATGGCTTATTT pLKO_005 846 CDS 100% 15.000 10.500 N Gk n/a
5 TRCN0000024657 CAGGGTTATATGCGCCTTATT pLKO.1 1428 CDS 100% 13.200 9.240 N Gk n/a
6 TRCN0000024658 CCTTCCACTTAGCACGTATTT pLKO.1 742 CDS 100% 13.200 9.240 N Gk n/a
7 TRCN0000319696 CCTTCCACTTAGCACGTATTT pLKO_005 742 CDS 100% 13.200 9.240 N Gk n/a
8 TRCN0000195270 CTTAGTCATCATCAAGTAGAA pLKO.1 422 CDS 100% 4.950 3.465 N GK n/a
9 TRCN0000024655 GCTGAACTTCTTAGTCATCAT pLKO.1 413 CDS 100% 4.950 3.465 N Gk n/a
10 TRCN0000350182 GCTGAACTTCTTAGTCATCAT pLKO_005 413 CDS 100% 4.950 3.465 N Gk n/a
11 TRCN0000195234 CTGAGATCTATGGCCTAATTA pLKO.1 1026 CDS 100% 15.000 9.000 N GK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001331046.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06278 pDONR223 100% 91.4% 96.7% None (many diffs) n/a
2 ccsbBroad304_06278 pLX_304 0% 91.4% 96.7% V5 (many diffs) n/a
3 TRCN0000473511 TCCACTTGCGAAGTCGGGCGCCAG pLX_317 31.9% 91.4% 96.7% V5 (many diffs) n/a
4 ccsbBroadEn_14655 pDONR223 0% 91.4% 96.7% None (many diffs) n/a
5 ccsbBroad304_14655 pLX_304 0% 91.4% 96.7% V5 (many diffs) n/a
6 TRCN0000470124 CTTTTCCAGCCGTATGCAGTACTA pLX_317 25.7% 91.4% 96.7% V5 (many diffs) n/a
7 ccsbBroadEn_10490 pDONR223 100% 84.9% 89.8% None (many diffs) n/a
8 ccsbBroad304_10490 pLX_304 0% 84.9% 89.8% V5 (many diffs) n/a
9 TRCN0000479938 GTACCAGTTGGTCTCCCACTAACC pLX_317 24.1% 84.9% 89.8% V5 (many diffs) n/a
10 ccsbBroadEn_06279 pDONR223 100% 81.4% 81.9% None (many diffs) n/a
11 ccsbBroad304_06279 pLX_304 0% 81.4% 81.9% V5 (many diffs) n/a
12 ccsbBroadEn_14656 pDONR223 0% 81.4% 81.9% None (many diffs) n/a
13 ccsbBroad304_14656 pLX_304 0% 81.4% 81.9% V5 (many diffs) n/a
14 TRCN0000474895 TTTCTTGTATCACAAGGATTACCA pLX_317 31.2% 81.4% 81.9% V5 (many diffs) n/a
Download CSV