Transcript: Mouse NR_002890.1

Mus musculus predicted gene 12070 (Gm12070), non-coding RNA.

Source:
NCBI, updated 2017-04-28
Taxon:
Mus musculus (mouse)
Gene:
Gm12070 (654472)
Length:
1742
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_002890.1
NBCI Gene record:
Gm12070 (654472)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_002890.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041459 AGTGGCAAAGTGGAGATTGTT pLKO.1 486 3UTR 100% 5.625 2.813 Y Gapdh n/a
2 TRCN0000041325 CTGGAGAAACCTGCCAAGTAT pLKO.1 1158 3UTR 100% 5.625 2.813 Y LOC224923 n/a
3 TRCN0000041757 AGTGGAGATTGTTGCCATCAA pLKO.1 494 3UTR 100% 4.950 2.475 Y Gm5138 n/a
4 TRCN0000041287 CAAATTCAACGGCACAGTCAA pLKO.1 575 3UTR 100% 4.950 2.475 Y LOC382226 n/a
5 TRCN0000041232 CATGTTTGTGATGGGTGTGAA pLKO.1 800 3UTR 100% 4.950 2.475 Y LOC382043 n/a
6 TRCN0000041231 CCAAGTATGATGACATCAAGA pLKO.1 1171 3UTR 100% 4.950 2.475 Y LOC382043 n/a
7 TRCN0000036663 CCTCAACTACATGGTCTACAT pLKO.1 530 3UTR 100% 4.950 2.475 Y LOC392549 n/a
8 TRCN0000041230 CGTGGAGTCTACTGGTGTCTT pLKO.1 698 3UTR 100% 4.950 2.475 Y LOC382043 n/a
9 TRCN0000041460 CTGAGTATGTCGTGGAGTCTA pLKO.1 688 3UTR 100% 4.950 2.475 Y Gapdh n/a
10 TRCN0000041327 GAAATATGACAACTCACTCAA pLKO.1 827 3UTR 100% 4.950 2.475 Y LOC224923 n/a
11 TRCN0000041802 GAACCACGAGAAATATGACAA pLKO.1 818 3UTR 100% 4.950 2.475 Y Gapdh n/a
12 TRCN0000041229 GACAACTTTGTCAAGCTCATT pLKO.1 1326 3UTR 100% 4.950 2.475 Y LOC382043 n/a
13 TRCN0000221345 GCTCATTTCCTGGTATGACAA pLKO.1 1340 3UTR 100% 4.950 2.475 Y GAPDH n/a
14 TRCN0000041756 GTCAAGCTCATTTCCTGGTAT pLKO.1 1335 3UTR 100% 4.950 2.475 Y Gm5138 n/a
15 TRCN0000041228 TCACTCAAGATTGTCAGCAAT pLKO.1 840 3UTR 100% 4.950 2.475 Y LOC382043 n/a
16 TRCN0000041755 CATGGTCTACATGTTCCAGTA pLKO.1 539 3UTR 100% 4.050 2.025 Y Gm5138 n/a
17 TRCN0000041754 TGACATCAAGAAGGTGGTGAA pLKO.1 1181 3UTR 100% 4.050 2.025 Y Gm5138 n/a
18 TRCN0000041801 CAATGAATACGGCTACAGCAA pLKO.1 1358 3UTR 100% 2.640 1.320 Y Gapdh n/a
19 TRCN0000041285 CATCCATGACAACTTTGGCAT pLKO.1 902 3UTR 100% 2.640 1.320 Y LOC382226 n/a
20 TRCN0000041462 CCCAGAACATCATCCCTGCAT pLKO.1 1021 3UTR 100% 2.640 1.320 Y Gapdh n/a
21 TRCN0000041800 GACAACTTTGGCATTGTGGAA pLKO.1 909 3UTR 100% 2.640 1.320 Y Gapdh n/a
22 TRCN0000041799 GAAGCTTGTCATCAACGGGAA pLKO.1 608 3UTR 100% 2.160 1.080 Y Gapdh n/a
23 TRCN0000041461 GTATGACAATGAATACGGCTA pLKO.1 1352 3UTR 100% 2.160 1.080 Y Gapdh n/a
24 TRCN0000041286 CCAGGTTGTCTCCTGCGACTT pLKO.1 1250 3UTR 100% 1.350 0.675 Y LOC382226 n/a
25 TRCN0000041753 CCCAGCAAGGACACTGAGCAA pLKO.1 1441 3UTR 100% 0.880 0.440 Y Gm5138 n/a
26 TRCN0000041284 GCCACCCAGAAGACTGTGGAT pLKO.1 960 3UTR 100% 0.880 0.440 Y LOC382226 n/a
27 TRCN0000041326 CATTGCTCTCAATGACAACTT pLKO.1 1313 3UTR 100% 0.495 0.248 Y LOC224923 n/a
28 TRCN0000041458 GCTGCCATTTGCAGTGGCAAA pLKO.1 474 3UTR 100% 0.405 0.203 Y Gapdh n/a
29 TRCN0000041739 CATGACAACTTTGGCATTGTA pLKO.1 906 3UTR 100% 5.625 2.813 Y Gm5069 n/a
30 TRCN0000041265 CCAGAACATCATCCCTGCATT pLKO.1 1022 3UTR 100% 4.950 2.475 Y LOC224508 n/a
31 TRCN0000041323 GACATCAAGAAGGTGGTGAAA pLKO.1 1182 3UTR 100% 4.950 2.475 Y LOC224923 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_002890.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06254 pDONR223 100% 51.1% None (many diffs) n/a
2 ccsbBroad304_06254 pLX_304 0% 51.1% V5 (many diffs) n/a
3 TRCN0000474158 ACCTGGGTGCATCCAGAAGGTTGA pLX_317 21.9% 51.1% V5 (many diffs) n/a
4 ccsbBroadEn_00615 pDONR223 100% 51.1% None (many diffs) n/a
5 ccsbBroad304_00615 pLX_304 0% 51.1% V5 (many diffs) n/a
6 TRCN0000465685 TTTTCCTTCCTAATCTATAGCCTT pLX_317 31.2% 51.1% V5 (many diffs) n/a
Download CSV