Construct: ORF TRCN0000476918
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013556.1_s317c1
- Derived from:
- ccsbBroadEn_10663
- DNA Barcode:
- CCTGTCGTTTGGTGACAACTCTGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NME1-NME2 (654364)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476918
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 654364 | NME1-NME2 | NME1-NME2 readthrough | NM_001018136.3 | 91.4% | 91.4% | 0_1ins75 |
| 2 | human | 654364 | NME1-NME2 | NME1-NME2 readthrough | NR_037149.2 | 68.8% | 1_253del;1130_1272del | |
| 3 | human | 4830 | NME1 | NME/NM23 nucleoside diphosp... | NM_198175.1 | 57.7% | 58.2% | (many diffs) |
| 4 | human | 4831 | NME2 | NME/NM23 nucleoside diphosp... | NM_001018137.3 | 52% | 52% | 0_1ins420 |
| 5 | human | 4831 | NME2 | NME/NM23 nucleoside diphosp... | NM_001018138.1 | 52% | 52% | 0_1ins420 |
| 6 | human | 4831 | NME2 | NME/NM23 nucleoside diphosp... | NM_001018139.2 | 52% | 52% | 0_1ins420 |
| 7 | human | 4831 | NME2 | NME/NM23 nucleoside diphosp... | NM_002512.4 | 52% | 52% | 0_1ins420 |
| 8 | human | 4830 | NME1 | NME/NM23 nucleoside diphosp... | NM_000269.2 | 49.2% | 45.8% | (many diffs) |
| 9 | human | 4831 | NME2 | NME/NM23 nucleoside diphosp... | NM_001198682.2 | 28% | 26.1% | 0_1ins420;227_228ins113;246_247ins97 |
| 10 | mouse | 18103 | Nme2 | NME/NM23 nucleoside diphosp... | NM_001077529.2 | 47% | 51% | (many diffs) |
| 11 | mouse | 18103 | Nme2 | NME/NM23 nucleoside diphosp... | NM_008705.5 | 47% | 51% | (many diffs) |
| 12 | mouse | 18102 | Nme1 | NME/NM23 nucleoside diphosp... | NM_008704.2 | 43.1% | 46.9% | (many diffs) |
| 13 | mouse | 433968 | Gm5566 | predicted pseudogene 5566 | XR_868740.1 | 42.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 945
- ORF length:
- 876
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggtgctactg tctactttag ggatcgtctt tcaaggcgag gggcctccta 121 tctcaagctg tgatacagga accatggcca actgtgagcg taccttcatt gcgatcaaac 181 cagatggggt ccagcggggt cttgtgggag agattatcaa gcgttttgag cagaaaggat 241 tccgccttgt tggtctgaaa ttcatgcaag cttccgaaga tcttctcaag gaacactacg 301 ttgacctgaa ggaccgtcca ttctttgccg gcctggtgaa atacatgcac tcagggccgg 361 tagttgccat ggtctgggag gggctgaatg tggtgaagac gggccgagtc atgctcgggg 421 agaccaaccc tgcagactcc aagcctggga ccatccgtgg agacttctgc atacaagttg 481 gcaggaccat ggccaacctg gagcgcacct tcatcgccat caagccggac ggcgtgcagc 541 gcggcctggt gggcgagatc atcaagcgct tcgagcagaa gggattccgc ctcgtggcca 601 tgaagttcct ccgggcctct gaagaacacc tgaagcagca ctacattgac cTGAAAGACC 661 GACCATTCTT CCCTGGGCTG GTGAAGTACA TGAACTCAGG GCCGGTTGTG GCCATGGTCT 721 GGGAGGGGCT GAACGTGGTG AAGACAGGCC GAGTGATGCT TGGGGAGACC AATCCAGCAG 781 ATTCAAAGCC AGGCACCATT CGTGGGGACT TCTGCATTCA GGTTGGCAGG AACATCATTC 841 ATGGCAGTGA TTCAGTAAAA AGTGCTGAAA AAGAAATCAG CCTATGGTTT AAGCCTGAAG 901 AACTGGTTGA CTACAAGTCT TGTGCTCATG ACTGGGTCTA TGAATTGCCA ACTTTCTTGT 961 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1021 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1081 GAAAGGACGA CCTGTCGTTT GGTGACAACT CTGTACGCGT TAAGTCgaca atcaacctct 1141 ggattacaaa atttgtgaaa gatt