Transcript: Mouse XR_868740.1

PREDICTED: Mus musculus predicted pseudogene 5566 (Gm5566), misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm5566 (433968)
Length:
587
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_868740.1
NBCI Gene record:
Gm5566 (433968)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_868740.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024637 AGGCGAGATCATCAAGCGATT pLKO.1 78 3UTR 100% 4.050 2.835 N LOC384257 n/a
2 TRCN0000024578 CATCAAGCGATTCGAGCAGAA pLKO.1 87 3UTR 100% 4.050 2.430 N Gm5425 n/a
3 TRCN0000024575 CGAGATCATCAAGCGATTCGA pLKO.1 81 3UTR 100% 3.000 1.800 N Gm5425 n/a
4 TRCN0000024635 CGAGTGTACCTTCATTGCCAT pLKO.1 27 3UTR 100% 2.640 1.584 N LOC384257 n/a
5 TRCN0000054519 AGAACACCTGAAGCAGCATTA pLKO.1 150 3UTR 100% 10.800 5.400 Y Nme2 n/a
6 TRCN0000287721 AGAACACCTGAAGCAGCATTA pLKO_005 150 3UTR 100% 10.800 5.400 Y Nme2 n/a
7 TRCN0000054521 AGACCAATCCAGCTGATTCAA pLKO.1 293 3UTR 100% 5.625 2.813 Y Nme2 n/a
8 TRCN0000287720 AGACCAATCCAGCTGATTCAA pLKO_005 293 3UTR 100% 5.625 2.813 Y Nme2 n/a
9 TRCN0000054518 GTTGGCAGGAACATCATTCAT pLKO.1 349 3UTR 100% 5.625 2.813 Y Nme2 n/a
10 TRCN0000287722 GTTGGCAGGAACATCATTCAT pLKO_005 349 3UTR 100% 5.625 2.813 Y Nme2 n/a
11 TRCN0000024906 ACATCATTCATGGCAGTGATT pLKO.1 359 3UTR 100% 4.950 2.475 Y Nme2 n/a
12 TRCN0000024574 GCAGCATTACATCGACCTGAA pLKO.1 162 3UTR 100% 4.050 2.025 Y Gm5425 n/a
13 TRCN0000024908 GCATTCAAGTTGGCAGGAACA pLKO.1 341 3UTR 100% 4.050 2.025 Y Nme2 n/a
14 TRCN0000054522 GACTACAAGTCTTGTGCCCAT pLKO.1 436 3UTR 100% 2.160 1.080 Y Nme2 n/a
15 TRCN0000379743 ATTCATGGCAGTGATTCAGTA pLKO_005 364 3UTR 100% 4.950 2.475 Y NME2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_868740.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14715 pDONR223 100% 69.9% None (many diffs) n/a
2 ccsbBroad304_14715 pLX_304 0% 69.9% V5 (many diffs) n/a
3 TRCN0000469993 CCAAGGCATCGCGTCTCAAAGTAA pLX_317 72.2% 69.9% V5 (many diffs) n/a
4 TRCN0000492213 TGTACTCCCGGGACTCAGACCACG pLX_317 92.3% 69.9% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000470841 CGTGCGTGAACAATGGCCCGGCTC pLX_317 40.9% 45.9% V5 (not translated due to prior stop codon) (many diffs) n/a
6 ccsbBroadEn_15341 pDONR223 100% 45.8% None (many diffs) n/a
7 ccsbBroad304_15341 pLX_304 0% 45.8% V5 (not translated due to prior stop codon) (many diffs) n/a
8 ccsbBroadEn_10663 pDONR223 100% 42.5% None (many diffs) n/a
9 ccsbBroad304_10663 pLX_304 0% 42.5% V5 (many diffs) n/a
10 TRCN0000476918 CCTGTCGTTTGGTGACAACTCTGT pLX_317 33.8% 42.5% V5 (many diffs) n/a
Download CSV