Transcript: Human NR_037149.2

Homo sapiens NME1-NME2 readthrough (NME1-NME2), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-25
Taxon:
Homo sapiens (human)
Gene:
NME1-NME2 (654364)
Length:
1272
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_037149.2
NBCI Gene record:
NME1-NME2 (654364)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_037149.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000010062 CCGCCTTGTTGGTCTGAAATT pLKO.1 427 3UTR 100% 13.200 6.600 Y NME1 n/a
2 TRCN0000196307 GAAATCAGCCTATGGTTTAAG pLKO.1 1058 3UTR 100% 13.200 6.600 Y NME2 n/a
3 TRCN0000234328 GAAATCAGCCTATGGTTTAAG pLKO_005 1058 3UTR 100% 13.200 6.600 Y NME1-NME2 n/a
4 TRCN0000318404 GAAATCAGCCTATGGTTTAAG pLKO_005 1058 3UTR 100% 13.200 6.600 Y NME2 n/a
5 TRCN0000218662 TCATGGCAGTGATTCAGTAAA pLKO_005 1024 3UTR 100% 13.200 6.600 Y NME1-NME2 n/a
6 TRCN0000010061 TCCGCCTTGTTGGTCTGAAAT pLKO.1 426 3UTR 100% 13.200 6.600 Y NME1 n/a
7 TRCN0000234326 TCCGCCTTGTTGGTCTGAAAT pLKO_005 426 3UTR 100% 13.200 6.600 Y NME1-NME2 n/a
8 TRCN0000381107 ACCAATCCAGCAGATTCAAAG pLKO_005 953 3UTR 100% 10.800 5.400 Y NME2 n/a
9 TRCN0000010108 AGCACTACATTGACCTGAAAG pLKO.1 822 3UTR 100% 10.800 5.400 Y NME2 n/a
10 TRCN0000234327 AGCACTACATTGACCTGAAAG pLKO_005 822 3UTR 100% 10.800 5.400 Y NME1-NME2 n/a
11 TRCN0000349498 AGCACTACATTGACCTGAAAG pLKO_005 822 3UTR 100% 10.800 5.400 Y NME2 n/a
12 TRCN0000381045 GGAGACCAATCCAGCAGATTC pLKO_005 949 3UTR 100% 10.800 5.400 Y NME1-NME2 n/a
13 TRCN0000381376 TGAAGGACCGTCCATTCTTTG pLKO_005 492 3UTR 100% 10.800 5.400 Y NME1-NME2 n/a
14 TRCN0000197030 GCTCATGACTGGGTCTATGAA pLKO.1 1109 3UTR 100% 5.625 2.813 Y NME2 n/a
15 TRCN0000318379 GCTCATGACTGGGTCTATGAA pLKO_005 1109 3UTR 100% 5.625 2.813 Y NME2 n/a
16 TRCN0000054518 GTTGGCAGGAACATCATTCAT pLKO.1 1007 3UTR 100% 5.625 2.813 Y Nme2 n/a
17 TRCN0000287722 GTTGGCAGGAACATCATTCAT pLKO_005 1007 3UTR 100% 5.625 2.813 Y Nme2 n/a
18 TRCN0000024906 ACATCATTCATGGCAGTGATT pLKO.1 1017 3UTR 100% 4.950 2.475 Y Nme2 n/a
19 TRCN0000379743 ATTCATGGCAGTGATTCAGTA pLKO_005 1022 3UTR 100% 4.950 2.475 Y NME2 n/a
20 TRCN0000010109 CCTATGGTTTAAGCCTGAAGA pLKO.1 1066 3UTR 100% 4.950 2.475 Y NME2 n/a
21 TRCN0000195380 CTGAAGAACTGGTTGACTACA pLKO.1 1080 3UTR 100% 4.950 2.475 Y NME2 n/a
22 TRCN0000010055 GCGTACCTTCATTGCGATCAA pLKO.1 343 3UTR 100% 4.950 2.475 Y NME1 n/a
23 TRCN0000234329 ACACAACAGCAGTCTCCTTCA pLKO_005 1140 3UTR 100% 4.050 2.025 Y NME1-NME2 n/a
24 TRCN0000195555 CTCAAGGAACACTACGTTGAC pLKO.1 470 3UTR 100% 4.050 2.025 Y NME1 n/a
25 TRCN0000010063 CGGCCTGGTGAAATACATGCA pLKO.1 514 3UTR 100% 2.640 1.320 Y NME1 n/a
26 TRCN0000024732 GCCTGGTGAAATACATGCACT pLKO.1 516 3UTR 100% 2.640 1.320 Y Nme1 n/a
27 TRCN0000010110 TTTAAGCCTGAAGAACTGGTT pLKO.1 1073 3UTR 100% 2.640 1.320 Y NME2 n/a
28 TRCN0000199489 GACTTCTGCATTCAGGTTGGC pLKO.1 992 3UTR 100% 2.160 1.080 Y NME2 n/a
29 TRCN0000318433 GACTTCTGCATTCAGGTTGGC pLKO_005 992 3UTR 100% 2.160 1.080 Y NME2 n/a
30 TRCN0000010102 TTCATCGCCATCAAGCCGGAC pLKO.1 695 3UTR 100% 0.400 0.200 Y NME2 n/a
31 TRCN0000199010 CAGAAGGGATTCCGCCTCGTG pLKO.1 761 3UTR 100% 0.000 0.000 Y NME2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_037149.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10663 pDONR223 100% 68.8% None 1_253del;1130_1272del n/a
2 ccsbBroad304_10663 pLX_304 0% 68.8% V5 1_253del;1130_1272del n/a
3 TRCN0000476918 CCTGTCGTTTGGTGACAACTCTGT pLX_317 33.8% 68.8% V5 1_253del;1130_1272del n/a
4 TRCN0000470841 CGTGCGTGAACAATGGCCCGGCTC pLX_317 40.9% 62.8% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_15341 pDONR223 100% 62.7% None (many diffs) n/a
6 ccsbBroad304_15341 pLX_304 0% 62.7% V5 (not translated due to prior stop codon) (many diffs) n/a
7 ccsbBroadEn_14715 pDONR223 100% 35.8% None 1_673del;1130_1272del n/a
8 ccsbBroad304_14715 pLX_304 0% 35.8% V5 1_673del;1130_1272del n/a
9 TRCN0000469993 CCAAGGCATCGCGTCTCAAAGTAA pLX_317 72.2% 35.8% V5 1_673del;1130_1272del n/a
10 TRCN0000492213 TGTACTCCCGGGACTCAGACCACG pLX_317 92.3% 35.8% V5 (not translated due to prior stop codon) 1_673del;1130_1272del n/a
11 TRCN0000491954 CGATCTATCACAATTATAACCTTA pLX_317 76.9% 33.9% V5 (not translated due to prior stop codon) (many diffs) n/a
12 ccsbBroadEn_01101 pDONR223 100% 33.8% None (many diffs) n/a
13 ccsbBroad304_01101 pLX_304 0% 33.8% V5 (many diffs) n/a
14 TRCN0000468949 CACCGCTGGGTGCTAGCGAGCCCG pLX_317 73.3% 33.8% V5 (many diffs) n/a
15 ccsbBroadEn_14714 pDONR223 0% 33.8% None (many diffs) n/a
16 ccsbBroad304_14714 pLX_304 0% 33.8% V5 (many diffs) n/a
17 TRCN0000479668 TTTTAGCACTCTCCAGTATATATA pLX_317 69.3% 33.8% V5 (many diffs) n/a
18 TRCN0000489477 CTTACCCCATGCGATACCGACTGC pLX_317 56.7% 33.8% V5 (many diffs) n/a
19 TRCN0000488282 CTTCCTTTCGAGACTCGATGACCG pLX_317 63.2% 33.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV